Comparative studies of the composition of bacterial microbiota associated with the ruminal content, ruminal epithelium and in the faeces of lactating dairy cows

Abstract

SummaryThe objective of this research was to compare the composition of bacterial microbiota associated with the ruminal content (RC), ruminal epithelium (RE) and faeces of Holstein dairy cows. The RC, RE and faecal samples were collected from six Holstein dairy cows when the animals were slaughtered. Community compositions of bacterial 16S rRNA genes from RC, RE and faeces were determined using a MiSeq sequencing platform with bacterial‐targeting universal primers 338F and 806R. UniFrac analysis revealed that the bacterial communities of RC, RE and faeces were clearly separated from each other. Statistically significant dissimilarities were observed between RC and faeces (P = 0.002), between RC and RE (P = 0.003), and between RE and faeces (P = 0.001). A assignment of sequences to taxa showed that the abundance of the predominant phyla Bacteroidetes was lower in RE than in RC, while a significant higher (P < 0.01) abundance of Proteobacteria was present in RE than in RC. When compared with the RC, the abundance of Firmicutes and Verrucomicrobia was higher in faeces, and RC contained a greater abundance of Bacteroidetes and Tenericutes. A higher proportions of Butyrivibrio and Campylobacter dominated RE as compared to RC. The faecal microbiota was less diverse than RC and dominated by genera Turicibacter and Clostridium. In general, these findings clearly demonstrated the striking compositional differences among RC, RE and faeces, indicating that bacterial communities are specific and adapted to the harbouring environment.

Effects of Astragalus membranaceus fiber on growth performance, nutrient digestibility, microbial composition, VFA production, gut pH, and immunity of weaned pigs

“…However, the abundance of Prevotella and Ruminococcus tended to be higher in the 2.5 AMSLF and the 7.50% AMSLF groups than in other treatment groups. Our results are in agreement with findings by Liu, Zhang, Zhang, Zhu, and Mao () who reported that Prevotella, Acetitomaculum Succiniclasticum, Saccharofermentans, Mogibacterium, and Ruminococcus were the dominant genera in ruminal content and the epithelium of lactating cows. The reason for increased in abundance of Prevotella and Ruminococcus in some treatment groups is unclear.…”

Geography, seasonality, and host‐associated population structure influence the fecal microbiome of a genetically depauparate Arctic mammal

“…Microbiome studies of wild animals often use nonfresh fecal samples due to their noninvasive nature and inclusivity of the entire digestive tract (Li et al, ; Liu et al, ; Liu, Zhang, Zhang, Zhu, & Mao, ; Pope et al, ; Salgado‐Flores et al, ). Though contamination is a concern with nonfresh fecal samples, our study corroborates with findings from other muskox microbiome studies that used immediate fecal sampling (Andersen‐Ranberg et al, ; Ungerfeld et al, ).…”

Alliin alters gut microbiota and gene expression of colonic epithelial tissues

“…DNA was extracted using the TIANamp Stool DNA Kit (Tiangen, Beijing, China) following the manufacturer’s instructions. The V3–V4 region of the bacterial 16S rDNA was amplified by PCR with a 20‐μl mixture containing 4 μl of 5 × FastPfu Buffer (TransGen Biotech, Beijing, China), 0.8 μl of 5 μM each primer (338F: ACTCCTACGGGAGGCAGCAG and 806R: GGACTACHVGGGTWTCTA AT) (Liu, Zhang, Zhang, Zhu, & Mao, ), 2 μl of 2.5 mM dNTPs, 0.4 μl of FastPfu Polymerase and 10 ng of template DNA. The PCR cycling conditions were as follows: 3 min of denaturation at 95°C followed by 27 cycles of 30 s at 94°C, 30 s at 55°C, and 45 s at 72°C, with a final extension at 72°C for 10 min.…”