Comparative Identification of MicroRNAs in Apis cerana cerana Workers’ Midguts in Response to Nosema ceranae Invasion

Chen, Dafu; Du, Yuguang; Chen, Huazhi; Yu, Fan; Fan, Xiangtao; Zhu, Zhiwei; Wang, Jie; Zheng, Yusheng; Hou, Chunsheng; Diao, Qingyun; Guo, Rui

doi:10.3390/insects10090258

Cited by 16 publications

(30 citation statements)

References 103 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The prepared spores of N. ceranae were subjected to microscopic observation using an optical microscope (SIOM, Shanghai, China). Furthermore, the total RNA of spores were isolated and used as templates for reverse transcription; the resulting cDNA was then used as templates for PCR amplification with previously described specific primers for N. ceranae and N. apis [ 22 , 23 ] and the amplified products were detected by 1.5% agarose gel electrophoresis (AGE). Sterile water was set as a negative control.…”

Section: Methodsmentioning

confidence: 99%

Comparative Transcriptome Investigation of Nosema ceranae Infecting Eastern Honey Bee Workers

Wang

et al. 2022

Insects

View full text Add to dashboard Cite

Apis cerana is the original host for Nosema ceranae, a widespread fungal parasite resulting in honey bee nosemosis, which leads to severe losses to the apiculture industry throughout the world. However, knowledge of N. ceranae infecting eastern honey bees is extremely limited. Currently, the mechanism underlying N. ceranae infection is still largely unknown. Based on our previously gained high-quality transcriptome datasets derived from N. ceranae spores (NcCK group), N. ceranae infecting Apis cerana cerana workers at seven days post inoculation (dpi) and 10 dpi (NcT1 and NcT2 groups), comparative transcriptomic investigation was conducted in this work, with a focus on virulence factor-associated differentially expressed genes (DEGs). Microscopic observation showed that the midguts of A. c. cerana workers were effectively infected after inoculation with clean spores of N. ceranae. In total, 1411, 604, and 38 DEGs were identified from NcCK vs. NcT1, NcCK vs. NcT2, and NcT1 vs. NcT2 comparison groups. Venn analysis showed that 10 upregulated genes and nine downregulated ones were shared by the aforementioned comparison groups. The GO category indicated that these DEGs were involved in a series of functional terms relevant to biological process, cellular component, and molecular function such as metabolic process, cell part, and catalytic activity. Additionally, KEGG pathway analysis suggested that the DEGs were engaged in an array of pathways of great importance such as metabolic pathway, glycolysis, and the biosynthesis of secondary metabolites. Furthermore, expression clustering analysis demonstrated that the majority of genes encoding virulence factors such as ricin B lectins and polar tube proteins displayed apparent upregulation, whereas a few virulence factor-associated genes such as hexokinase gene and 6-phosphofructokinase gene presented downregulation during the fungal infection. Finally, the expression trend of 14 DEGs was confirmed by RT-qPCR, validating the reliability of our transcriptome datasets. These results together demonstrated that an overall alteration of the transcriptome of N. ceranae occurred during the infection of A. c. cerana workers, and most of the virulence factor-related genes were induced to activation to promote the fungal invasion. Our findings not only lay a foundation for clarifying the molecular mechanism underlying N. ceranae infection of eastern honey bee workers and microsporidian–host interaction.

show abstract

Section: Methodsmentioning

confidence: 99%

Comparative Transcriptome Investigation of Nosema ceranae Infecting Eastern Honey Bee Workers

Wang

et al. 2022

Insects

View full text Add to dashboard Cite

show abstract

“…The prepared spores of N. ceranae was subjected to microscopic observation using an optical microscope (SIOM, Shanghai, China). Further, total DNA of spores were isolated and used as templates for reverse transcription; the resulting cDNA was then used as templates for PCR amplification with previously described specific primers for N. ceranae and N. apis [22][23]; the amplified products were detected by 1.5% agarose gel electrophoresis (AGE). Sterile water was set as a negative control.…”

Section: Microscopic Observation and Pcr Validation Of N Ceranae Sporesmentioning

confidence: 99%

Comparative transcriptome investigation of Nosema ceranae infecting eastern honeybee workers

Chen

Guo

2022

Preprint

View full text Add to dashboard Cite

Apis cerana is the original host for Nosema ceranae, a widespread fungal parasite resulting in bee nosemosis, which leads to severe losses for apiculture industry throughout the world. However, knowledge of N. ceranae infecting eastern honeybees is extremely limited. Currently, the mechanism underlying N. ceranae infection is still largely unknown. Based on our previously gained high-quality transcriptome datasets, comparative transcriptomic investigation was conducted in this work, with a focus on virulence factor-associated differentially expressed genes (DEGs). Microscopic observation showed that A. c. cerana workers midguts were effectively infected after inoculation with clean spores of N. ceranae. Totally, 1411, 604, and 38 DEGs were identified from NcCK vs. NcT1, NcCK vs. NcT2 and NcT1 vs. NcT2 comparison groups. Venn analysis showed that ten up-regulated genes and nine down-regulated ones were shared by aforementioned comparison groups. GO category indicated these DEGs were involved in a series of functional terms relevant to biological process, cellular component, and molecular function, such as metabolic process, cell part, and catalytic activity. Additionally, KEGG pathway analysis suggested that the DEGs were engaged in an array of pathways of great importance, such as metabolic pathway, glycolysis, and biosynthesis of secondary metabolites. Further, expression clustering analysis demonstrated that majority of genes encoding virulence factors such as ricin B lectins and polar tube proteins displayed apparent up-regulation, whereas a few virulence factor-associated genes such as hexokinase gene and 6-phosphofructokinase gene presented down-regulation during the fungal infection. Finally, the expression trend of 14 DEGs was confirmed by RT-qPCR, validating the reliability of our transcriptome datasets. These results together demonstrated that an overall alteration of the transcriptome of N. ceranae occurred during the infection of A. c. ceranae workers, and most of virulence factor-related genes were induced to activation to promote the fungal invasion. Our findings not only lay a foundation for clarifying the molecular mechanism underlying N. ceranae infection of eastern honeybee workers, but also shed light on developing novel targets for microsporidiosis control.

show abstract

“…Before and during the whole experiment, no Varroa was detected. RT-PCR was performed to examine the prevalence of two bee microsporidia (N. ceranae and Nosema apis) and seven common bee viruses (ABPV, BQCV, CBPV, DWV, KBV, IAPV, and SBV) in the newly emergent A. c. cerana workers using previously developed specific primers (Table S1) [38][39][40][41][42][43][44]. Agarose gel electrophoresis (AGE) showed that no signal bands were amplified from the above-mentioned two microsporidia and seven viruses (Figure S1).…”

Section: Transcriptome Data Sourcementioning

confidence: 99%

“…Workers' midgut at 12 dpi without N. ceranae was set as a negative control, and sterile water as another negative control. PCR amplification was conducted on a T100 thermo cycler (BIO-RAD) with previously described primers for N. ceranae (F: CGAGCGGTTTCCCATCTCAGTA; R: AAAACACCG-GAACTCGTCAGCT) [38] and the following conditions: pre-denaturation step at 94 • C for 5 min; 37 amplification cycles of denaturation at 94 • C for 50 s, annealing at 59 • C for 30 s, and elongation at 72 • C for 1 min; followed by a final elongation step at 72 • C for 10 min. The PCR products were examined on 1.5% AGE with Genecolor (Gene-Bio) staining.…”

Section: Confirmation Of Effective Infection Of Eastern Honeybee Workers By N Ceranaementioning

confidence: 99%

Immune Response of Eastern Honeybee Worker to Nosema ceranae Infection Revealed by Transcriptomic Investigation

Xing

Zhou

Long

et al. 2021

Insects

View full text Add to dashboard Cite

Here, a comparative transcriptome investigation was conducted based on high-quality deep sequencing data from the midguts of Apis cerana cerana workers at 7 d post-inoculation (dpi) and 10 dpi with Nosema ceranae and corresponding un-inoculated midguts. PCR identification and microscopic observation of paraffin sections confirmed the effective infection of A. c. cerana worker by N. ceranae. In total, 1127 and 957 N. ceranae-responsive genes were identified in the infected midguts at 7 dpi and 10 dpi, respectively. RT-qPCR results validated the reliability of our transcriptome data. GO categorization indicated the differentially expressed genes (DEGs) were respectively engaged in 34 and 33 functional terms associated with biological processes, cellular components, and molecular functions. Additionally, KEGG pathway enrichment analysis showed that DEGs at 7 dpi and 10 dpi could be enriched in 231 and 226 pathways, respectively. Moreover, DEGs in workers’ midguts at both 7 dpi and 10 dpi were involved in six cellular immune pathways such as autophagy and phagosome and three humoral immune pathways such as the Toll/Imd signaling pathway and Jak-STAT signaling pathway. In addition, one up-regulated gene (XM_017055397.1) was enriched in the NF-κB signaling pathway in the workers’ midgut at 10 dpi. Further investigation suggested the majority of these DEGs were engaged in only one immune pathway, while a small number of DEGs were simultaneously involved in two immune pathways. These results together demonstrated that the overall gene expression profile in host midgut was altered by N. ceranae infection and some of the host immune pathways were induced to activation during fungal infection, whereas some others were suppressed via host–pathogen interaction. Our findings offer a basis for clarification of the mechanism underlying the immune response of A. c. cerana workers to N. ceranae infection, but also provide novel insights into eastern honeybee-microsporodian interaction.

show abstract

Comparative Identification of MicroRNAs in Apis cerana cerana Workers’ Midguts in Response to Nosema ceranae Invasion

Cited by 16 publications

References 103 publications

Comparative Transcriptome Investigation of Nosema ceranae Infecting Eastern Honey Bee Workers

Comparative Transcriptome Investigation of Nosema ceranae Infecting Eastern Honey Bee Workers

Comparative transcriptome investigation of Nosema ceranae infecting eastern honeybee workers

Immune Response of Eastern Honeybee Worker to Nosema ceranae Infection Revealed by Transcriptomic Investigation

Contact Info

Product

Resources

About