Cloning, Sequencing andIn SilicoAnalysis of Omp C ofSalmonellaTyphimurium

Abstract

<jats:p><jats:italic>Salmonella</jats:italic>Typhimurium is an important pathogen having a broad host range. In human population it causes mostly gastroenteritis but there are reports in which it was found to be responsible to cause several lethal diseases like endocarditis and meningitis. Poultry products are the major sources of this organism in India as these are consumed at various stages of cooking. The available vaccines have their own limitations such as short-term immunity. Outer membrane proteins have shown some promising potential, so in the present study Omp C of<jats:italic>Salmonella</jats:italic>Typhimurium was cloned and sequenced to explore the possibility of development of r-DNA vaccine against<jats:italic>Salmonella</jats:italic>Typhimurium for poultry. The sequence of Omp C was studied for antigenic indexing, epitope mapping, and MHC mapping using various bioinformatic tools. The ORF analysis revealed a complete coding region of approximately 1000 bp. Five major and 13 minor B-cell epitopes were identified having an antigenic index of 1.7. The sequences also showed major histocompatibility complex (MHC) class I and class II binding region indicating a potential of eliciting cell-mediated immune response. The findings indicate that Omp C may be proven as promising candidate for development of r-DNA vaccine against<jats:italic>Salmonella</jats:italic>Typhimurium.</jats:p>

Cloning, Sequencing and In Silico Characterization of OmpF Protein of Salmonella typhimurium for its Immune-Potential

“…An epitope having 10 or more amino acid are generally considered to be a good B cell epitope to elicit humoral immune response, in case Omp F protein we found very long epitopes making it a high potential vaccine candidate. In a similar study conducted in OmpC by Jha et al, (2012) there were only 13 B cell epitopes, and the epitope scores were less in comparison to OmpF in this study.…”

“…Phenylalanine at C terminus provide stability and proper assembly of protein into the outer membrane (Ruffolo et al, 1996) Surface proteins of Salmonella have been considered as a potential vaccine candidate. Some of the outer membrane protein had been studied and described its immunogenic potential (Jha et al, 2012;Saxena et al, 2012;Jha et al, 2015).To date, there are only limited studies were conducted on OmpF protein of Salmonella typhimurium. The functional unit of OmpF porin is a homo-trimer and is formed by 16-stranded beta-barrel with three beta barrel monomers in its outer membrane (Balasubramaniam et al, 2012).…”

Heterogeneous expression and functional evaluation of in silico characterized recombinant OmpC of Salmonella Typhimurium as a functional poultry vaccine to eradicate zoonotic transmission

“…The presence of many epitopes was revealed in the sequence including 13 B-cell epitopes, out of which eight were predicted to be strongly immunogenic, 14 MHC I and several MHC II epitopes (Jha et al, 2012). Further, eight major variable regions were found by multiple sequence alignment with the related sequences having high surface probability and B-cell recognition potential, indicating the high immunogenic potential of the putative protein (Jha et al, 2012). These in silico studies conducted earlier by us and western blot directed the animal trials for OmpC protein.…”

“…The ompC gene from S. Typhimurium MTCC 3231, was cloned in pJET1.2 blunt cloning vector using primers: Forward primer-5' GGATCCATGCGTATCGGCTT 3', Reverse primer-5' AAGCTTTTAGAACTGGTAAA 3' (Clone JET TM PCR cloning kit, Fermentas, USA) (Jha et al, 2012) and sequenced by Ocimum Biosolutions Ltd., Hyderabad. The recombinant plasmid was purified by alkali lysis method (Sambrook and Russell, 2001), and was verified by double digestion using BamHI and HindIII.…”

Detection of virulence genes and investigation of the immunogenicity of outer membrane proteins of Salmonella enterica

“…Immunization with the OMPs of Salmonella is considered to be a potential approach for conferring protection against typhoid. The OMPs of Gram-negative bacteria include a family of poreforming proteins that form water-filled channels that allow small hydrophilic solutes to pass through the pore, in addition to other non-porin proteins that play significant roles in the pathogenicity of the organism [34,35].…”