Chromatin and Transcriptional Response to Loss of TBX1 in Early Differentiation of Mouse Cells

Cirino, Andrea; Aurigemma, Ilaria; Franzese, Monica; Lania, Gabriella; Righelli, Dario; Ferrentino, Rosa; Illingworth, Elizabeth; Angelini, Claudia; Baldini, Antonio

doi:10.3389/fcell.2020.571501

Cited by 8 publications

(7 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…ATAC-seq data analysis. ATAC-seq analysis pipeline has been described previously 86 ; however, we describe the methods here as well. We removed Nextera Transposase Sequence primers 87 in the range 33-47 bp using cutadapt 88 with the following option -a CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -A CTGTCTCTTATACACATCTGACGCTGCCGACGA.…”

Section: Methodsmentioning

confidence: 99%

Single cell multi-omic analysis identifies a Tbx1-dependent multilineage primed population in murine cardiopharyngeal mesoderm

et al. 2021

Self Cite

View full text Add to dashboard Cite

The poles of the heart and branchiomeric muscles of the face and neck are formed from the cardiopharyngeal mesoderm within the pharyngeal apparatus. They are disrupted in patients with 22q11.2 deletion syndrome, due to haploinsufficiency of TBX1, encoding a T-box transcription factor. Here, using single cell RNA-sequencing, we now identify a multilineage primed population within the cardiopharyngeal mesoderm, marked by Tbx1, which has bipotent properties to form cardiac and branchiomeric muscle cells. The multilineage primed cells are localized within the nascent mesoderm of the caudal lateral pharyngeal apparatus and provide a continuous source of cardiopharyngeal mesoderm progenitors. Tbx1 regulates the maturation of multilineage primed progenitor cells to cardiopharyngeal mesoderm derivatives while restricting ectopic non-mesodermal gene expression. We further show that TBX1 confers this balance of gene expression by direct and indirect regulation of enriched genes in multilineage primed progenitors and downstream pathways, partly through altering chromatin accessibility, the perturbation of which can lead to congenital defects in individuals with 22q11.2 deletion syndrome.

show abstract

Section: Methodsmentioning

confidence: 99%

Single cell multi-omic analysis identifies a Tbx1-dependent multilineage primed population in murine cardiopharyngeal mesoderm

et al. 2021

Self Cite

View full text Add to dashboard Cite

show abstract

“…We performed in vitro differentiation of mES cells that have been gene-edited to lack any functional Tbx1 and the parental cell line (Cirino et al, 2020). We used the protocol published by Andersen et al (2018) with minor modifications because it induces robust expression of the Tbx1 gene at day 6 (d6) of differentiation (Andersen et al, 2018).…”

Section: Resultsmentioning

confidence: 99%

Cardiac Outflow tract septation defects in a DiGeorge syndrome model respond to Minoxidil treatment

Aurigemma,

Ferrentino,

Krishnan

et al. 2024

Preprint

Self Cite

View full text Add to dashboard Cite

Background: The T-BOX transcription factor TBX1 is essential for the development of the pharyngeal apparatus and it is haploinsufficient in DiGeorge syndrome (DGS), a developmental anomaly associated with congenital heart disease and other abnormalities. The murine model recapitulates the heart phenotype and showed collagen accumulation. Methods: We first used a cellular model to study gene expression during cardiogenic differentiation of WT and Tbx1-/- mouse embryonic stem cells. Then we used a mouse model of DGS to test whether interfering with collagen accumulation using an inhibitor of lysyl hydroxylase would modify the cardiac phenotype of the mutant. Results and conclusions: In the cell differentiation model, loss of Tbx1 was associated with up regulation of a subset of ECM-related genes, including several collagen genes. In the in vivo model, early prenatal treatment with Minoxidil, a lysyl hydroxylase inhibitor, ameliorated the cardiac outflow tract septation phenotype in Tbx1 mutant fetuses, but it had no effect on septation in WT fetuses. We conclude that TBX1 suppresses a subset of ECM-related genes. The partial rescue of the septation phenotype through Minoxidil treatment suggests that inhibiting collagen cross-linking reduces the impact of the phenotypic consequences of Tbx1 mutation.

show abstract

“…DiGeorge syndrome is caused by a microdeletion of chromosome 22 and characterized by cardiovascular malformations [302]. Cirino et al studied the gene expression and chromatin remodeling in cellular models of Tbx1 loss of function mutation in mouse P19Cl6 cells and mESCs [303]. Tbx1 is expressed in the developmental phase of cardiopharyngeal mesoderm and its deletion is a requirement for the development of the 4th pharyngeal arch artery.…”

Section: Crispr/cas9 Editingmentioning

confidence: 99%

Engineering the cardiac tissue microenvironment

Ronan,

Bahcecioglu,

Aliyev

et al. 2023

Prog. Biomed. Eng.

View full text Add to dashboard Cite

In this article we review the microfabrication approaches, with a focus on bioprinting and organ-on-chip technologies, used to engineer cardiac tissue. First, we give a brief introduction to heart anatomy and physiology, and the developmental stages of the heart from fetal stages to adulthood. We also give information on the cardiac tissue microenvironment, including the cells residing in the heart, the biochemical composition and structural organization of the heart extracellular matrix, the signaling factors playing roles in heart development and maturation, and their interactions with one another. We then give a brief summary of both cardiovascular diseases and the current treatment methods used in the clinic to treat these diseases. Second, we explain how tissue engineering recapitulates the development and maturation of the normal or diseased heart microenvironment by spatially and temporally incorporating cultured cells, biomaterials, and growth factors (GF). We briefly expand on the cells, biomaterials, and GFs used to engineer the heart, and the limitations of their use. Next, we review the state-of-the-art tissue engineering approaches, with a special focus on bioprinting and heart-on-chip technologies, intended to (i) treat or replace the injured cardiac tissue, and (ii) create cardiac disease models to study the basic biology of heart diseases, develop drugs against these diseases, and create diagnostic tools to detect heart diseases. Third, we discuss the recent trends in cardiac tissue engineering, including the use of machine learning, CRISPR/Cas editing, exosomes and microRNAs, and immune modeling in engineering the heart. Finally, we conclude our article with a brief discussion on the limitations of cardiac tissue engineering and our suggestions to engineer more reliable and clinically relevant cardiac tissues.

show abstract

Chromatin and Transcriptional Response to Loss of TBX1 in Early Differentiation of Mouse Cells

Cited by 8 publications

References 37 publications

Single cell multi-omic analysis identifies a Tbx1-dependent multilineage primed population in murine cardiopharyngeal mesoderm

Single cell multi-omic analysis identifies a Tbx1-dependent multilineage primed population in murine cardiopharyngeal mesoderm

Cardiac Outflow tract septation defects in a DiGeorge syndrome model respond to Minoxidil treatment

Engineering the cardiac tissue microenvironment

Contact Info

Product

Resources

About