Chitosan-stabilized selenium nanoparticles alleviate cardio-hepatic damage in type 2 diabetes mellitus model via regulation of caspase, Bax/Bcl-2, and Fas/FasL-pathway

Mohamed, Amany Abdel-Rahman; Khater, Safaa I.; Arisha, Ahmed Hamed; Metwally, Mohamed M.M.; Mostafa‐Hedeab, Gomaa; El‐Shetry, Eman S.

doi:10.1016/j.gene.2020.145288

Cited by 52 publications

(32 citation statements)

References 71 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The hyperglycemia and insulin resistance could be related to the STZ induced selective pancreatic β-cells damage, which mainly linked to DNA alkylation and, to a lesser extent, ROS generation, and nitric oxide [17]. However, in our previous study [38], the MF and/or CH-SeNPs oral dosing, particularly the combined therapy, significantly suppressed the HFD/STZ induced increment in the glucose and insulin levels. Thus, the earlier study proposed the potent antidiabetic activity of CH-SeNPs and MF combined therapy, which could be related to the CH-SeNPs capacity to renew the beta cells activity, decreasing the blood glucose level and enhancing insulin release [56].…”

Section: Discussionmentioning

confidence: 56%

“…Initially, in our earlier work [38], the HFD/STZ treated rats showed clear hyperglycemic condition (276.74 ± 6.03 mg blood glucose/dl) and hyperinsulinemia (36.84 ± 0.58 mg insulin/dL) when compared to the control group (95.72 ± 0.42 and 11.62 ± 0.25, respectively). The hyperglycemia and insulin resistance could be related to the STZ induced selective pancreatic β-cells damage, which mainly linked to DNA alkylation and, to a lesser extent, ROS generation, and nitric oxide [17].…”

Section: Discussionmentioning

confidence: 84%

“…There is evidence that normal lipid metabolism is crucial for normal spermatogenesis. Hyperglycemia is often associated with abnormalities in lipid profiles, like elevated serum levels of total cholesterol, triglycerides, low-density lipoprotein cholesterol, and declined serum levels of high-density lipoprotein cholesterol [38,58]. Increased ROS in diabetes also has a major impact on sperm, because of the presence in the cell membrane of various polyunsaturated fatty acids [59].…”

Section: Discussionmentioning

confidence: 99%

“…MF was purchased as tablets containing 500 mg (Eva Pharma, Cairo, Egypt). The preparation and characterization of CH SeNPs have been previously described in our earlier study [38]. All other reagents/chemicals used were of analytical grade (Sigma, St. Louis, MO, USA).…”

Section: Tested Compoundsmentioning

confidence: 99%

See 3 more Smart Citations

Chitosan-Stabilized Selenium Nanoparticles and Metformin Synergistically Rescue Testicular Oxidative Damage and Steroidogenesis-Related Genes Dysregulation in High-Fat Diet/Streptozotocin-Induced Diabetic Rats

et al. 2020

Self Cite

View full text Add to dashboard Cite

Background: this study examined the metformin (MF) and/or chitosan stabilized selenium nanoparticles (CH-SeNPs) efficacy to alleviate the male reproductive function impairment in a high-fat diet feed with low-dose streptozotocin (HFD/STZ) induced type 2 diabetes mellitus (T2DM) diabetic rat model. Methods: control non-diabetic, HFD/STZ diabetic, HFD/STZ+MF, HFD/STZ+CH-SeNPs, and HFD/STZ+MF+CH-SeNPs rat groups were used. After 60 days, semen evaluation, hormonal assay, enzymatic antioxidant, lipid peroxidation, testis histopathology, and the steroidogenesis-related genes mRNA expressions were assessed. Results: in the HFD/STZ diabetic rats, sperm count and motility, male sexual hormones, and testicular antioxidant enzymes were significantly reduced. However, sperm abnormalities and testicular malondialdehyde were significantly incremented. The steroidogenesis-related genes, including steroidogenic acute regulatory protein (StAr), cytochrome11A1 (CYP11A1), cytochrome17A1 (CYP17A1), and hydroxysteroid 17-beta dehydrogenase 3 (HSD17B3), and the mitochondrial biogenesis related genes, including peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGCα) and sirtuin (SIRT), were significantly downregulated in the HFD/STZ diabetic rats. However, CYP19A1mRNA expression was significantly upregulated. In contrast, MF and/or CH-SeNPs oral dosing significantly rescued the T2DM-induced sperm abnormalities, reduced sperm motility, diminished sexual hormones level, testicular oxidative damage, and steroidogenesis-related genes dysregulation. In the MF and CH-SeNP co-treated group, many of the estimated parameters differ considerably from single MF or CH-SeNPs treated groups. Conclusions: the MF and CH-SeNPs combined treatment could efficiently limit the diabetic complications largely than monotherapeutic approach and they could be considered a hopeful treatment option in the T2DM.

show abstract

Section: Discussionmentioning

confidence: 56%

Section: Discussionmentioning

confidence: 84%

Section: Discussionmentioning

confidence: 99%

Section: Tested Compoundsmentioning

confidence: 99%

See 2 more Smart Citations

Chitosan-Stabilized Selenium Nanoparticles and Metformin Synergistically Rescue Testicular Oxidative Damage and Steroidogenesis-Related Genes Dysregulation in High-Fat Diet/Streptozotocin-Induced Diabetic Rats

et al. 2020

Self Cite

View full text Add to dashboard Cite

show abstract

“…β‐actin was used as the reference gene. (Mohamed et al., 2021) The sequences of sense and antisense primers for the rat NF‐κB were 5′‐GTCACCATAGCAACCGTCTC‐3′ and 5′‐CACAGCGACCATCAATAGCA‐3′, and the sequences of sense and antisense primers for the rat Caspase‐3 were 5′‐ TGGACAACAACGAAACCTCC −3′ and 5′‐CCAGGCACAGTATCTCTTGC‐3′ respectively. The data were analysed as fold changes according to the formula 2 −ΔΔCt .…”

Section: Methodsmentioning

confidence: 99%

Achillea millefolium alleviates testicular damage in paclitaxel‐intoxicated rats via attenuation of testicular oxido‐inflammatory stress and apoptotic responses

Okkay

Çiçek

et al. 2021

Andrologia

View full text Add to dashboard Cite

The aim of this study was to investigate the effects of Achillea millefolium extract in paclitaxel‐induced testicular toxicity in rats. The groups were designed as (1) control, (2) paclitaxel (8 mg/kg, intraperitoneally), (3) paclitaxel (8 mg/kg, intraperitoneally) + Achillea millefolium (200 mg/kg, orally for 14 consecutive days) and (4) paclitaxel (8 mg/kg, intraperitoneally) + Achillea millefolium (400 mg/kg, orally for 14 consecutive days). Serum levels of testosterone, luteinising hormone and follicle‐stimulating hormone, as well as total antioxidant capacity and total oxidant status were measured one day after receiving the last dose of Achillea millefolium extract. Testicular superoxide dismutase activity, malondialdehyde, tumour necrosis factor alpha and interleukin‐1β levels, the expressions of nuclear factor kappa B and caspase‐3 were evaluated. In addition, testicular sections were evaluated histopathologically and 8‐hydroxy‐2′‐deoxyguanosine was detected immunohistochemically. Achillea millefolium improved the levels of luteinising hormone, follicle‐stimulating hormone and testosterone, upregulated testicular antioxidant enzymes and downregulated inflammation. Furthermore, we observed that Achillea millefolium restored testicular histopathological structure and significantly suppressed oxidative DNA damage and apoptosis by reducing the expression of caspase‐3. Taken together, our results suggest that Achillea millefolium has protective effects against paclitaxel‐induced testicular toxicity and is a promising natural product with the potential to improve male fertility.

show abstract

Selenium Nanoparticles for Biomedical Applications: From Development and Characterization to Therapeutics

Ferro

Florindo

Santos

2021

Adv Healthcare Materials

236

146

View full text Add to dashboard Cite

Selenium (Se) is an essential element to human health that can be obtained in nature through several sources. In the human body, it is incorporated into selenocysteine, an amino acid used to synthesize several selenoproteins, which have an active center usually dependent on the presence of Se. Although Se shows several beneficial properties in human health, it has also a narrow therapeutic window, and therefore the excessive intake of inorganic and organic Se‐based compounds often leads to toxicity. Nanoparticles based on Se (SeNPs) are less toxic than inorganic and organic Se. They are both biocompatible and capable of effectively delivering combinations of payloads to specific cells following their functionalization with active targeting ligands. Herein, the main origin of Se intake, its role on the human body, and its primary biomedical applications are revised. Particular focus will be given to the main therapeutic targets that are explored for SeNPs in cancer therapies, discussing the different functionalization methodologies used to improve SeNPs stability, while enabling the extensive delivery of drug‐loaded SeNP to tumor sites, thus avoiding off‐target effects.

show abstract

Chitosan-stabilized selenium nanoparticles alleviate cardio-hepatic damage in type 2 diabetes mellitus model via regulation of caspase, Bax/Bcl-2, and Fas/FasL-pathway

Cited by 52 publications

References 71 publications

Chitosan-Stabilized Selenium Nanoparticles and Metformin Synergistically Rescue Testicular Oxidative Damage and Steroidogenesis-Related Genes Dysregulation in High-Fat Diet/Streptozotocin-Induced Diabetic Rats

Chitosan-Stabilized Selenium Nanoparticles and Metformin Synergistically Rescue Testicular Oxidative Damage and Steroidogenesis-Related Genes Dysregulation in High-Fat Diet/Streptozotocin-Induced Diabetic Rats

Achillea millefolium alleviates testicular damage in paclitaxel‐intoxicated rats via attenuation of testicular oxido‐inflammatory stress and apoptotic responses

Selenium Nanoparticles for Biomedical Applications: From Development and Characterization to Therapeutics

Contact Info

Product

Resources

About