Characterization of the KstR-dependent promoter of the gene for the first step of the cholesterol degradative pathway in Mycobacterium smegmatis

Abstract

The KstR-dependent promoter of the MSMEG_5228 gene of Mycobacterium smegmatis, which encodes the 3-b-hydroxysteroid dehydrogenase (3-b HSD MS ) responsible for the first step in the cholesterol degradative pathway, has been characterized. Primer extension analysis of the P 5228 promoter showed that the transcription starts at the ATG codon, thus generating a leaderless mRNA lacking a 59 untranslated region (59UTR). Footprint analyses demonstrated experimentally that KstR specifically binds to an operator region of 31 nt containing the quasi-palindromic sequence AACTGGAACGTGTTTCAGTT, located between the "5 and "35 positions with respect to the transcription start site. This region overlaps with the "10 and "35 boxes of the P 5228 promoter, suggesting that KstR represses MSMEG_5228 transcription by preventing the binding of RNA polymerase. Using a P 5228 -b-galactosidase fusion we have demonstrated that KstR is able to work as a repressor in a heterologous system like Escherichia coli. A 3D model of the KstR protein revealed folding typical of TetR-type regulators, with two domains, i.e. a DNA-binding N-terminal domain and a regulator-binding C-terminal domain composed of six helices with a long tunnel-shaped hydrophobic pocket that might interact with a putative highly hydrophobic inducer. The finding that similar P 5228 promoter regions have been found in all mycobacterial strains examined, with the sole exception of Mycobacterium tuberculosis, provides new clues about the role of cholesterol in the pathogenicity of this micro-organism. INTRODUCTIONMycobacterium smegmatis belongs to the fast-growing nonpathogenic mycobacteria and has been widely used as a model organism to study the biology of other virulent and extremely slow-growing species like Mycobacterium tuberculosis; therefore much interest has been focused on this system for its potential use in genetic studies. Interestingly, it has been described that only fast-growing non-pathogenic mycobacteria were able to grow on cholesterol as a sole carbon source (Av-Gay & Sobouti, 2000); however, more recent results have demonstrated that cholesterol is also used as a carbon source during infection of M. tuberculosis (Pandey & Sassetti, 2008). Although recent biochemical and structural studies have assigned a role for some of the mycobacterial genes in cholesterol catabolism, the complete degradative pathway and its specific regulation remain to be fully established (Capyk et al., 2009;Knol et al., 2008;Lack et al., 2010;Yam et al., 2009). Recently, it has been shown that cholesterol utilization in mycobacteria is controlled by two TetR-type transcriptional repressors (Kendall et al., 2007(Kendall et al., , 2010. One of these repressors, named KstR, is encoded by the Rv3574 gene in M. tuberculosis and by the MSMEG_6042 gene in M. smegmatis. KstR controls the expression of 83 cholesterol catabolic genes (kstR regulon) (Kendall et al., 2007); many of these genes are essential for virulence, highlighting the importance of cholesterol catabolism in the pathogenici...

Exploring the Use of Lipid Based Nano-Formulations for the Management of Tuberculosis

“…Though various species of mycobacteria are plentily available in soil and water but M. tuberculosis along with seven other very close myco-bacterial species are recognized as the M. tuberculosis complex-MTb possesses specifically adapted genetic structure to infect human population [12]. TB spreads through person-to-person contact from one infected person to others via airborne transmission of small droplet nuclei (0.5-5 μm) produced through coughs, sneezes, sing or even forceful speaking [13].…”

Deciphering the Transcriptional Regulation of Cholesterol Catabolic Pathway in Mycobacteria

“…This study aims to shed light on the regulation of the cholesterol degradation pathway in mycobacteria, which is apparently controlled by only two TetR-type transcriptional repressors: KstR and KstR2 (2,3,20). KstR is encoded by gene Rv3574 in M. tuberculosis and gene MSMEG_6042 in M. smegmatis and controls the expression of 83 cholesterol catabolic genes (kstR regulon) responsible for activating the upper and central pathway (2,19).…”

“…Several genes in the kstR regulon are essential for virulence, demonstrating the importance of cholesterol catabolism in the pathogenesis of M. tuberculosis (7,(22)(23)(24)(25)(26). KstR binds to the target promoters as a dimer through a conserved motif (TNNAACNNGTTNNA) (2,20). Despite the critical role played by kstR regulon, the mechanisms involved in this regulation are still poorly understood, and the inducer molecules of KstR are still unidentified (20).…”

“…KstR binds to the target promoters as a dimer through a conserved motif (TNNAACNNGTTNNA) (2,20). Despite the critical role played by kstR regulon, the mechanisms involved in this regulation are still poorly understood, and the inducer molecules of KstR are still unidentified (20). The repression of most described TetR-like regulators is released in the presence of an inducer molecule, causing a conformational change in the protein promoting gene transcription (21).…”

“…The repression of most described TetR-like regulators is released in the presence of an inducer molecule, causing a conformational change in the protein promoting gene transcription (21). Thus, KstR and KstR2 might be induced by cholesterol or cholestenone because these compounds induce the expression of the kstR and kstR2 regulons in vivo (2,3,19,20). In this respect, we used EMSA analyses to demonstrate the ability of KstR to bind the MSMEG_5228 * This work was supported by Spanish Ministry of Economy and Competitiveness Grants BFU2009-11545-CO3-03, BFU2012-39695-CO2-01, BFU2011-24615, and CSD2009-00088.…”