Characterization of the AlkS/P_alkB‐expression system as an efficient tool for the production of recombinant proteins in Escherichia coli fed‐batch fermentations

Abstract

The availability of suitable, well-characterized, and robust expression systems remains an essential requirement for successful metabolic engineering and recombinant protein production. We investigated the suitability of the Pseudomonas putida GPo1-derived AlkS/P(alkB) expression system in strictly aqueous cultures. By applying the apolar inducer dicyclopropylketone (DCPK) to express green fluorescent protein (GFP) from this system in Escherichia coli and analyzing the resulting cultures on single-cell level by flow cytometry, we found that this expression system gives rise to a homogeneous population of cells, even though the overall system is expected to have a positive feed-back element in the expression of the regulatory gene alkS. Overexpressing E. coli's serine hydroxymethyltransferase gene glyA, we showed that the system was already fully turned on at inducer concentrations as low as 0.005% (v/v). This allows efficient mass production of recombinant enzymes even though DCPK concentrations decreased from 0.05% to 0.01% over the course of a fully aerated cultivation in aqueous medium. Therefore, we elaborated the optimum induction procedure for production of the biocatalytically promising serine hydroxymethyltransferase and found volumetric and specific productivity to increase with specific growth rate in glucose-limited fed-batch cultures. Acetate excretion as a result of recombinant protein production could be avoided in an optimized fermentation protocol by switching earlier to a linear feed. This protocol resulted in a production of a final cell dry weight (CDW) concentration of 52 g/L, producing recombinant GlyA with a maximum specific activity of 6.3 U/mg total protein.

NADH Availability Limits Asymmetric Biocatalytic Epoxidation in a Growing Recombinant Escherichia coli Strain

“…The organism used in this study was Escherichia coli JM101 [supE thi ⌬(lac-proAB) FЈ(traD36 lacI q ⌬lacZM15 proAB)] (42) harboring plasmid pSPZ10 (51), which contains the styrene monooxygenase genes styAB of Pseudomonas sp. strain VLB120 (50) under the control of the alk regulatory system of Pseudomonas putida Gpo1 (40,65). LB medium containing 1% (wt/vol) glucose and 50 mg liter Ϫ1 kanamycin was used for the seed culture.…”

“…In order to elucidate whether growth of E. coli JM101(pSPZ10) was inhibited by styAB overexpression or styrene epoxidation, we carried out continuous cultivations with various amounts of inducer in the absence of a styrene feed (Fig. 3), profiting from the fact that expression under the control of the alk regulatory system can be fine-tuned by controlling the applied inducer concentration (8,40). For this purpose, we used an aqueous single-phase medium instead of an organic/aqueous emulsion.…”

Model‐based characterization of an amino acid racemase from Pseudomonas putida DSM 3263 for application in medium‐constrained continuous processes

“…The culture was operated in batch mode until a sharp increase in the concentration of the dissolved oxygen concentration indicated consumption of all available glucose. Then, an exponential feed consisting of (per liter) 20 g of MgSO 4 Á 7H 2 O, 0.2 g of thiamine, 6 mL of trace element solution TES (Makart et al, 2007), and 500 g of glucose was Figure 1. Dynamic kinetic resolution (DKR) scheme of racemic substrate S R,S that yields enantiopure product P R while its enantiomeric counterpart P S is not formed.…”

“…In protocol one, 3 L of a previously described mineral medium with glucose as the carbon source (Makart et al, 2007) were inoculated with 100 mL of a preculture in the same medium. The culture was operated in batch mode until a sharp increase in the concentration of the dissolved oxygen concentration indicated consumption of all available glucose.…”

“…The gene coding for the amino acid racemase was amplified by PCR from P. putida DSM 3263 genomic DNA using the sense primer 5 0 GGGCGGCCATATGCAATTTAGCCGTACCCT-CCTGGCTG 3 0 (introducing an NdeI site (underlined) at the start of the gene) and the antisense primer 5 0 GGCGCGCCTCAGTCGACGAGAATCTTCGGGTTGGA 3 0 (adding an AscI site (underlined) after the stop codon of the gene). The PCR product was inserted as a NdeI/ AscI fragment into equally digested pESM3 (Makart et al, 2007), resulting in the expression vector pRRR32. Here, the gene is under control of the alkS/P alkB expression system, which can be induced by the addition of dicyclopropylketone (DCPK) (Sticher et al, 1997).…”