Characterization of Gordonia sp. strain F.5.25.8 capable of dibenzothiophene desulfurization and carbazole utilization

Santos, Silvia Cristina Cunha dos; Alviano, Daniela Sales; Alviano, Celuta Sales; Pádula, Marcelo de; Leitão, Álvaro C.; Martins, Orlando B.; Ribeiro, Claudia Maria Soares; Sassaki, M. Y. M.; Matta, Carla P. S.; Bevilaqua, Juliana V.; Sebastian, G.V.; Seldin, Lucy

doi:10.1007/s00253-005-0154-z

Cited by 57 publications

(18 citation statements)

References 33 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Recently, a Gordonia sp. strain was reported to be capable of DBT desulfurization and CA utilization (19). However, its desulfurization activity was very low and no data concerning selective CA degradation and oil processing were given.…”

mentioning

confidence: 99%

Selective Biodegradation of S and N Heterocycles by a Recombinant Rhodococcus erythropolis Strain Containing Carbazole Dioxygenase

Yu¹,

Xu²,

Zhu³

et al. 2006

Appl Environ Microbiol

View full text Add to dashboard Cite

The carbazole dioxygenase genes were introduced into a dibenzothiophene degrader. The recombinant Rhodococcus erythropolis SN8 was capable of efficiently degrading dibenzothiophene and carbazole simultaneously. SN8 could also degrade various alkylated derivatives of carbazole and dibenzothiophene in FS4800 crude oil by just a one-step bioprocess.Acid precipitation resulting from fossil fuel combustion has driven enormous efforts to remove contaminants from fossil fuels. Heteroatoms such as nitrogen and sulfur in crude oil can also poison the catalysts used in catalytic cracking and hydrotreating processes (6). Microorganisms possess the capability to metabolize sulfur-and nitrogen-containing compounds in crude oil (18). Dibenzothiophene (DBT) has been used as a model sulfur compound, and research has been focused on strains that can selectively remove sulfur by a 4S pathway, in which DBT is converted to 2-hydroxybiphenyl (2-HBP) (5,8,12,14,15). Carbazole (CA) is the most abundant nitrogencontaining compound in many petroleum samples and was therefore chosen as a model compound (7). A variety of CAdegrading microorganisms have been reported (9,10,17,21,22). These different CA degraders follow similar degradation pathways, and the first step is catalysis by CA dioxygenase, which converts CA to 2Ј-aminobiphenyl-2, 3-diol (18, 20).Unlike biodesulfurization, where sulfur is selectively removed from substrates, leaving the hydrocarbon portion of the molecule intact, the pathway of CA degradation only liberates nitrogen in the course of completely degrading the substrates (1). Mutants or recombinants capable of carrying out only the first step(s) of the CA degradation pathway could be used to avoid the loss of fuel value. Since the nitrogen compounds in petroleum refinery feed stocks are known to poison catalysts, the microbial products from CA degradation might be expected to cause less catalyst inhibition than their parent compounds (18). Therefore, there is much hope that the efficiency of conventional catalytic processing of crude oil can be improved by microbial modification of nitrogenous catalyst poisons. Blocked mutants also have the ability to preserve the carbon content of the fuel being treated, retaining the fuel value. However, there have been no reports concerning host engineering to investigate the partial transformation pathway of CA in crude oil as a possible alternative to its total removal.In this study, a CA dioxygenase gene was introduced into the excellent DBT degrader Rhodococcus erythropolis XP (24), which could desulfurize DBT via a 4S pathway. The resultant recombinant was designated SN8. Based on the DNA sequence of Pseudomonas sp. strain CA10 (20), the primers used were as follows: Primer1, 5Ј-GCCGACTAGTAAGGAGATGGACGT GGCG-3Ј (SpeI restriction site underlined); Primer2, 5Ј-CAT GCAAATTTCCTTCTAGTTCCTTCAGCCCGAAACGTGC GCTT-3Ј; Primer3, 5Ј-AAGCGCACGTTTCGGGCTGAAGG AACTAGAAGGAAATTTGCATG-3Ј; Primer4, 5Ј-GACGAG TACTGCAGCGCCGTCATACGTTGC-3Ј (ScaI site underlined). The underlined bases in Primer2 matche...

show abstract

mentioning

confidence: 99%

Selective Biodegradation of S and N Heterocycles by a Recombinant Rhodococcus erythropolis Strain Containing Carbazole Dioxygenase

Yu¹,

Xu²,

Zhu³

et al. 2006

Appl Environ Microbiol

View full text Add to dashboard Cite

show abstract

“…Many researchers have focused their studies on the isolation and identification of carbazole-degrading microorganisms, such as Pseudomonas (7,25), Sphingomonas (32), Ralstonia (29), Bacillus (14), Gordonia (28), and Mycobacterium and Xanthamonas (8). Our laboratory has also isolated and constructed several bacteria that can degrade these heterocyclic compounds (6,18,19,20,43,44).…”

mentioning

confidence: 99%

Degradation of Carbazole by Microbial Cells Immobilized in Magnetic Gellan Gum Gel Beads

Wang

Gai

et al. 2007

Appl Environ Microbiol

View full text Add to dashboard Cite

“…5b). Natural isolates and genetically engineered strains capable of simultaneously using DBTs and carbazoles have been reported (Gai et al, 2007;Santos et al, 2006;Yu et al, 2006a). These microorganisms have not been used for BDS/BDN purposes yet, and therefore the influence of some process variables has not been studied yet.…”

Section: Application Of Microorganisms To the Processing And Upgradinmentioning

confidence: 98%

Application of Microorganisms to the Processing and Upgrading of Crude Oil and Fractions

Morales¹,

Ayala²,

Vázquez-Duhalt³

et al. 2010

Handbook of Hydrocarbon and Lipid Microbiology

View full text Add to dashboard Cite

Characterization of Gordonia sp. strain F.5.25.8 capable of dibenzothiophene desulfurization and carbazole utilization

Cited by 57 publications

References 33 publications

Selective Biodegradation of S and N Heterocycles by a Recombinant Rhodococcus erythropolis Strain Containing Carbazole Dioxygenase

Selective Biodegradation of S and N Heterocycles by a Recombinant Rhodococcus erythropolis Strain Containing Carbazole Dioxygenase

Degradation of Carbazole by Microbial Cells Immobilized in Magnetic Gellan Gum Gel Beads

Application of Microorganisms to the Processing and Upgrading of Crude Oil and Fractions

Contact Info

Product

Resources

About