Characterisation of a Non-canonical Genetic Code in the Oxymonad Streblomastix strix

Abstract

The genetic code is one of the most highly conserved characters in living organisms. Only a small number of genomes have evolved slight variations on the code, and these non-canonical codes are instrumental in understanding the selective pressures maintaining the code. Here, we describe a new case of a non-canonical genetic code from the oxymonad flagellate Streblomastix strix. We have sequenced four protein-coding genes from S. strix and found that the canonical stop codons TAA and TAG encode the amino acid glutamine. These codons are retained in S. strix mRNAs, and the legitimate termination codons of all genes examined were found to be TGA, supporting the prediction that this should be the only true stop codon in this genome. Only four other lineages of eukaryotes are known to have evolved non-canonical nuclear genetic codes, and our phylogenetic analyses of a-tubulin, b-tubulin, elongation factor-1 a (EF-1 alpha), heat-shock protein 90 (HSP90), and small subunit rRNA all confirm that the variant code in S. strix evolved independently of any other known variant. The independent origin of each of these codes is particularly interesting because the code found in S. strix, where TAA and TAG encode glutamine, has evolved in three of the four other nuclear lineages with variant codes, but this code has never evolved in a prokaryote or a prokaryote-derived organelle. The distribution of non-canonical codes is probably the result of a combination of differences in translation termination, tRNAs, and tRNA synthetases, such that the eukaryotic machinery preferentially allows changes involving TAA and TAG.

High Mannose-binding Lectin with Preference for the Cluster of α1–2-Mannose from the Green Alga Boodlea coacta Is a Potent Entry Inhibitor of HIV-1 and Influenza Viruses

“…Several green algal species belonging to the orders Dasycladales and Siphonocladales, to which B. coacta belongs, have been found to use a noncanonical genetic code where TAA and TAG encode glutamine instead of translation termination (31)(32)(33), as well as oxymonads (34,35), diplomonads (36,37), and some ciliates (38,39). We found that BCA cDNA uses the noncanonical genetic code as shown in Fig.…”

Gene Replacement of Fructose-1,6-Bisphosphate Aldolase Supports the Hypothesis of a Single Photosynthetic Ancestor of Chromalveolates

“…PCR products were cloned and sequenced; the sequence was used to design a Rhodomonas-specific primer for 3Ј rapid amplification of cDNA ends, and these products were cloned and sequenced to retrieve a complete 3Ј end sequence. DNA was prepared as described (16), and the class I FBA was amplified by using primers CGCAGTTGCAAACTAGATACGATG and GCTGGAGGC CGATGAGGCTTTCTTC. Sequences encoding class I and class II FBAs were also identified and assembled from the Thalassiosira pseudonana (diatom) genome sequence and EST data (genome.jgi-psf.org/thaps1/thaps1.home.html).…”

Phylogenetic and Primary Sequence Characterization of Cathepsin B Cysteine Proteases from the Oxymonad Flagellate Monocercomonoides

“…Cathepsins from these protists may provide novel insight into the biology of this molecule as oxymonads are evolutionarily distant from the well-characterized cell biological models of either human or, to a lesser extent, kinetoplastids. Oxymonads also exhibit aberrant cell biological features, including the use, in some taxa, of an alternate genetic code (Keeling and Leander 2003), and the lack in all oxymonads of both visible Golgi stacks and obvious mitochondrially derived organelles (Simpson 2003). Further, because oxymonads are commensals of some metazoan taxa, as well as being heterotrophic flagellates (Kulda and Nohynková 1978), cathepsins may play an important biological role for these protists.…”