Chaperone assisted recombinant expression of a mycobacterial aminoacylase in Vibrio natriegens and Escherichia coli capable of N-lauroyl-L-amino acid synthesis

Abstract

Background Aminoacylases are highly promising enzymes for the green synthesis of acyl-amino acids, potentially replacing the environmentally harmful Schotten-Baumann reaction. Long-chain acyl-amino acids can serve as strong surfactants and emulsifiers, with application in cosmetic industries. Heterologous expression of these enzymes, however, is often hampered, limiting their use in industrial processes. Results We identified a novel mycobacterial aminoacylase gene from Mycolicibacterium smegmatis MKD 8, cloned and expressed it in Escherichia coli and Vibrio natriegens using the T7 overexpression system. The recombinant enzyme was prone to aggregate as inclusion bodies, and while V. natriegens Vmax™ could produce soluble aminoacylase upon induction with isopropyl β-d-1-thiogalactopyranoside (IPTG), E. coli BL21 (DE3) needed autoinduction with lactose to produce soluble recombinant protein. We successfully conducted a chaperone co-expression study in both organisms to further enhance aminoacylase production and found that overexpression of chaperones GroEL/S enhanced aminoacylase activity in the cell-free extract 1.8-fold in V. natriegens and E. coli. Eventually, E. coli ArcticExpress™ (DE3), which co-expresses cold-adapted chaperonins Cpn60/10 from Oleispira antarctica, cultivated at 12 °C, rendered the most suitable expression system for this aminoacylase and exhibited twice the aminoacylase activity in the cell-free extract compared to E. coli BL21 (DE3) with GroEL/S co-expression at 20 °C. The purified aminoacylase was characterized based on hydrolytic activities, being most stable and active at pH 7.0, with a maximum activity at 70 °C, and stability at 40 °C and pH 7.0 for 5 days. The aminoacylase strongly prefers short-chain acyl-amino acids with smaller, hydrophobic amino acid residues. Several long-chain amino acids were fairly accepted in hydrolysis as well, especially N-lauroyl-L-methionine. To initially evaluate the relevance of this aminoacylase for the synthesis of N-acyl-amino acids, we demonstrated that lauroyl-methionine can be synthesized from lauric acid and methionine in an aqueous system. Conclusion Our results suggest that the recombinant enzyme is well suited for synthesis reactions and will thus be further investigated.

Novel aminoacylases from Streptomyces griseus DSM 40236 and their recombinant production in Streptomyces lividans

“…Cultivation media, metal salts, amino acids, Tris (tris(hydroxymethyl)aminomethane), and solvents were from Carl Roth (Karlsruhe, Germany). Acetyl amino acids were purchased from Sigma‐Aldrich (Taufkirchen, Germany), and other acyl amino acids were chemically synthesized as described previously [8]. Molecular biology reagents were from Thermo Fisher Scientific (Langerwehe, Germany).…”

“…The resulting DNA sequence was commercially ordered and synthesized by GeneArt (Thermo Fisher Scientific, USA). As described previously, the genes were amplified using primers with BsaI overhangs for Golden Gate cloning into pET28‐eforRED [8]. The primers used for amplification were P14 (GGTCTCCCATGTGGAGTCATCCTCAATTCGAAAAATCC) and P15 (GGTCTCTCTCAGCTATGATCAATAAAGCGATCCAGCACG) for SgAA NTag, P16 (GGTCTCCCATGAGCGAAAGCAGCACCGG) and P17 (GGTCTCTCTCATTTTTCGAATTGAGGATGACTCCATCC) for SgAA CTag, P16 and P15 for SgAA without tag, P14 and P18 (GGTCTCTCTCATTCATTCGGACGAACATAAACGGTCTG) for SgELA NTag, P19 (GGTCTCCCATGAGCCAGAGCACCGCAC) and P17 for SgELA CTag, P19 and P18 for SgELA without tag.…”

“…Recombinant expression in E. coli was conducted with E. coli BL21(DE3), E. coli BL21(DE3) pGro7, and E. coli ArcticExpress(DE3) as previously described [8]. TB medium was used for growth.…”

“…With the motivation to establish a biocatalytic production of these biosurfactants, aminoacylases have been investigated and show high potential to replace the environmentally harmful Schotten–Baumann synthesis. Aminoacylases that were shown to be capable of synthesis of N‐acyl‐ l ‐amino acids have been identified in Streptomyces [5–7], Mycolicibacterium [8], Burkholderia [9], and pig liver [10,11].…”

“…For SmAA, no synthesis has been shown yet [16]. The aminoacylase from M. smegmatis (MsAA) is homologous to SmAA and SamAA and has been shown to catalyze acylation of amino acids as well [8]. Further aminoacylase members of the M20A peptidase family are pAcy1 and hAcy1 from porcine and human liver, respectively [18,19].…”