Cell sex affects extracellular matrix protein expression and proliferation of smooth muscle progenitor cells derived from human pluripotent stem cells

Abstract

BackgroundSmooth muscle progenitor cells (pSMCs) differentiated from human pluripotent stem cells (hPSCs) hold great promise for treating diseases or degenerative conditions involving smooth muscle pathologies. However, the therapeutic potential of pSMCs derived from men and women may be very different. Cell sex can exert a profound impact on the differentiation process of stem cells into somatic cells. In spite of advances in translation of stem cell technologies, the role of cell sex and the effect of sex hormones on the differentiation towards mesenchymal lineage pSMCs remain largely unexplored.MethodsUsing a standard differentiation protocol, two human embryonic stem cell lines (one male line and one female line) and three induced pluripotent stem cell lines (one male line and two female lines) were differentiated into pSMCs. We examined differences in the differentiation of male and female hPSCs into pSMCs, and investigated the effect of 17β-estradiol (E2) on the extracellular matrix (ECM) metabolisms and cell proliferation rates of the pSMCs. Statistical analyses were performed by using Student’s t test or two-way ANOVA, p < 0.05.ResultsMale and female hPSCs had similar differentiation efficiencies and generated morphologically comparable pSMCs under a standard differentiation protocol, but the derived pSMCs showed sex differences in expression of ECM proteins, such as MMP-2 and TIMP-1, and cell proliferation rates. E2 treatment induced the expression of myogenic gene markers and suppressed ECM degradation activities through reduction of MMP activity and increased expression of TIMP-1 in female pSMCs, but not in male pSMCs.ConclusionshPSC-derived pSMCs from different sexes show differential expression of ECM proteins and proliferation rates. Estrogen appears to promote maturation and ECM protein expression in female pSMCs, but not in male pSMCs. These data suggest that intrinsic cell-sex differences may influence progenitor cell biology.Electronic supplementary materialThe online version of this article (doi:10.1186/s13287-017-0606-2) contains supplementary material, which is available to authorized users.

Sex-dependent VEGF expression underlies variations in human pluripotent stem cell to endothelial progenitor differentiation

“…Sex hormones and receptors have also been shown to affect only female hematopoietic stem cell self-renewal 36 . Distinctions in proliferation of smooth muscle progenitor cells derived from hPSCs have also been shown as a function of cell sex in addition to disparity in extracellular matrix protein expression in these cells; however, no difference in differentiation efficiency was observed 37 . Differences in autosomal gene expression between male and female hPSCs have been reported, suggesting that male and female cells could respond differently to the same differentiation stimuli 38 .…”

“…Many methods, currently used to generate endothelial progenitors for further differentiation to hemogenic or endothelial lineages, rely on the use of VEGF among other growth factors 10,37,39,40 . Based on previous experiments, the addition of Sunitinib, a VEGF receptor inhibitor, at any stage of the endothelial progenitor differentiation will result in abrogation of the endothelial progenitor population, which highlights the importance of endogenous VEGF pathway in endothelial progenitor differentiation 27 .…”

Synergistic Improvement in Children with Cerebral Palsy Who Underwent Double-Course Human Wharton’s Jelly Stem Cell Transplantation

“…Ample evidence supports the notion that there are donor-dependent associations between directional differentiation capacity and vascular support of MSCs. Moreover, studies focused on the sexes of the donors have reported potential gender differences in the results of stem cell treatment of certain diseases [43–45], and these may be related to the expression of hormonal receptors [46, 47]. hWJSCs derived from Wharton's Jelly of the umbilical cord have been reported to possess the properties of both mesenchymal and embryonic stem cells [48].…”

Secretomes of human pluripotent stem cell-derived smooth muscle cell progenitors upregulate extracellular matrix metabolism in the lower urinary tract and vagina

“…The differentiated cells were dissociated with Acutase (Innovative Cell Technologies, San Diego, CA) and prepared for magnetic-activated cell sorting (MACS) and uorescence-activated cell sorting (FACS) of CD31 + /CD34 + vascular progenitor cells (VPCs) [24]. Brie y, the cells were rst immunolabeled with CD34 microbeads for MACS (Miltenyi Biotec, Auburn, CA), and magnetic labeling was performed according to the manufacturer's instruction.…”

“…Total RNA (1 µg) was reverse transcribed into cDNA using the M-MLV reverse transcriptase system (Thermo Scienti c). PCR primers were described previously [17,24], except human TIMP2 (Sense: AAGCGGTCAGTGAGAAGGAA; Anti-sense: GATGTTCAAAGGGCCTGAGA), rat MMP2 (Sense: GTAAAGTATGGGAACGCTGATGGC; Anti-sense: CTTCTCAAAGTTGTACGTGGTGGA) and rat TIMP2 (Sense: ACACGCTTAGCATCACCCAGAA; Anti-sense: CAGTCCATCCAGAGGCACTCAT The slides were visually scored by four people separately for elastin length (1 = short, 2 = moderate, 3 = long), thickness (1 = thin, 2 = moderate, 3 = thick) and density (1 = sparce, 2 = moderate density, 3 = dense), collagen density (1 = sparce, 2 = moderate density, 3 = dense). The scorers were blinded to the group assignments.…”