CD81 knockout promotes chemosensitivity and disrupts in vivo homing and engraftment in acute lymphoblastic leukemia

Quagliano, Anthony; Gopalakrishnapillai, Anilkumar; Kolb, E. Anders; Barwe, Sonali P.

doi:10.1182/bloodadvances.2020001592

Cited by 20 publications

(15 citation statements)

References 60 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…As such, its overexpression or downregulation has served as a prognostic marker in several tumor types, including breast, lung, prostate, melanoma, brain cancer, and lymphoma [ 78 , 79 , 80 ]. In our analysis, despite the low frequency of CD81 positive cases, the results indicate that CD81 contributes to a worse DFS and unfavorable prognosis, further corroborating with the literature [ 81 , 82 ].…”

Section: Discussionsupporting

confidence: 92%

Assessment of TSPAN Expression Profile and Their Role in the VSCC Prognosis

Ferreira

Almeida

Anjos

et al. 2021

IJMS

View full text Add to dashboard Cite

The role and prognostic value of tetraspanins (TSPANs) in vulvar squamous cell carcinoma (VSCC) remain poorly understood. We sought to primarily determine, at both the molecular and tissue level, the expression profile of the TSPANs CD9, CD63, CD81, and CD82 in archived VSCC samples (n = 117) and further investigate their clinical relevance as prognostic markers. Our studies led us to identify CD63 as the most highly expressed TSPAN, at the gene and protein levels. Multicomparison studies also revealed that the expression of CD9 was associated with tumor size, whereas CD63 upregulation was associated with histological diagnosis and vascular invasion. Moreover, low expression of CD81 and CD82 was associated with worse prognosis. To determine the role of TSPANs in VSCC at the cellular level, we assessed the mRNA levels of CD63 and CD82 in established metastatic (SW962) and non-metastatic (SW954) VSCC human cell lines. CD82 was found to be downregulated in SW962 cells, thus supporting its metastasis suppressor role. However, CD63 was significantly upregulated in both cell lines. Silencing of CD63 by siRNA led to a significant decrease in proliferation of both SW954 and SW962. Furthermore, in SW962 particularly, CD63-siRNA also remarkably inhibited cell migration. Altogether, our data suggest that the differential expression of TSPANs represents an important feature for prognosis of VSCC patients and indicates that CD63 and CD82 are likely potential therapeutic targets in VSCC.

show abstract

Section: Discussionsupporting

confidence: 92%

Assessment of TSPAN Expression Profile and Their Role in the VSCC Prognosis

Ferreira

Almeida

Anjos

et al. 2021

IJMS

View full text Add to dashboard Cite

show abstract

“…To investigate CD81 gene role and function in some malignancies, it had been knocked out by the CRISPR-Cas9 system in several cell lines. Quagliano et al harnessed pSpCas9 (BB)-2A-GFP (PX458) to clone guide sequence (GGCGCTGTCATGATGTTCGT) targeting exon 3 of CD81 [28]. They successfully knocked out CD81 in precursor leukemia cell lines Nalm6 and Sup-B15.…”

Section: Discussionmentioning

confidence: 99%

Plasmid-based CRISPR-Cas9 system efficacy for introducing targeted mutations in CD81 gene of MDA-MB-231 cell line

Kaboli

Rahimi

Taromchi

et al. 2022

Folia Histochem Cytobiol.

View full text Add to dashboard Cite

Introduction. Breast cancer has been represented a challenging issue worldwide as it is one of the major leading causes of death among women. CD81 gene, a member of the tetraspanin protein family, has been associated with the development of human cancers. Genome editing technologies, particularly the CRISPR-Cas9 system, have shown rapid progress in gene function studies. In this study, we aimed to evaluate the ability of the CRISPR-Cas9 plasmid-based system to modify specific regions of the CD81 gene in the MDA-MB-231 breast cancer cell line. Materials and methods. Using bioinformatics database search, four different single guide RNAs (sgRNAs) to target exon 3 and exon 5 of the CD81 gene were designed. The intended sgRNAs sequences were cloned into the expression plasmid pSpCas9(BB)-2A-GFP (PX458) bearing sgRNA scaffold backbone, Cas9, and EGFP coding sequences, which was confirmed by colony PCR and sequencing. Transfection efficiency was determined by fluorescence microscopy and flow cytometry analysis. Gene editing efficiency was measured qualitatively and quantitatively using the T7E1 and TIDE software, respectively.Results. Our data show that expression constructs were successfully introduced into MDA-MB-231 cells with an acceptable transfection efficiency. Two sgRNAs that were afforded to introduce significant mutations in their target regions were detected by TIDE software (p-value < 0.05). To the best of our knowledge, CD81 gene editing in these cells has been investigated for the first time in this study using the CRISPR/Cas9 technique. Conclusions.Taken together, our data show that the CRISPR-Cas9 system can change the genomic sequence in the target area of MDA-MB-231 cells. Along with previous studies, we propose forethought when using T7E1-based quantitative indel estimates, as comparing activities of multiple gRNAs with the T7E1 assay may lead to inaccurate conclusions. Instead, estimating non-homologous end-joining events (NHEJ) by Sanger sequencing and subsequent TIDE analysis is recommended.

show abstract

“…Involved in lymphocyte cell membrane organization (Schaffer and Minguet, 2020). Knockout disrupts engraftment in acute lymphoblastic leukemia (Quagliano et al, 2020). Expressed on microglia (Reynolds and Mahajan, 2020) Tetraspanin29 TSPAN29, CD9, BA2, MIC3, MRP-1, P24…”

Section: Low Tissue Specificitymentioning

confidence: 99%

Tetraspanins as Potential Modulators of Glutamatergic Synaptic Function

Becic

Leifeld

Shaukat

et al. 2022

Front. Mol. Neurosci.

View full text Add to dashboard Cite

Tetraspanins (Tspans) comprise a membrane protein family structurally defined by four transmembrane domains and intracellular N and C termini that is found in almost all cell types and tissues of eukaryotes. Moreover, they are involved in a bewildering multitude of diverse biological processes such as cell adhesion, motility, protein trafficking, signaling, proliferation, and regulation of the immune system. Beside their physiological roles, they are linked to many pathophysiological phenomena, including tumor progression regulation, HIV-1 replication, diabetes, and hepatitis. Tetraspanins are involved in the formation of extensive protein networks, through interactions not only with themselves but also with numerous other specific proteins, including regulatory proteins in the central nervous system (CNS). Interestingly, recent studies showed that Tspan7 impacts dendritic spine formation, glutamatergic synaptic transmission and plasticity, and that Tspan6 is correlated with epilepsy and intellectual disability (formerly known as mental retardation), highlighting the importance of particular tetraspanins and their involvement in critical processes in the CNS. In this review, we summarize the current knowledge of tetraspanin functions in the brain, with a particular focus on their impact on glutamatergic neurotransmission. In addition, we compare available resolved structures of tetraspanin family members to those of auxiliary proteins of glutamate receptors that are known for their modulatory effects.

show abstract

CD81 knockout promotes chemosensitivity and disrupts in vivo homing and engraftment in acute lymphoblastic leukemia

Cited by 20 publications

References 60 publications

Assessment of TSPAN Expression Profile and Their Role in the VSCC Prognosis

Assessment of TSPAN Expression Profile and Their Role in the VSCC Prognosis

Plasmid-based CRISPR-Cas9 system efficacy for introducing targeted mutations in CD81 gene of MDA-MB-231 cell line

Tetraspanins as Potential Modulators of Glutamatergic Synaptic Function

Contact Info

Product

Resources

About