Caveolin-1 promotes glioma progression and maintains its mitochondrial inhibition resistance

Abstract

Background Glioma is a lethal brain cancer and lacking effective therapies. Challenges include no effective therapeutic target, intra- and intertumoral heterogeneity, inadequate effective drugs, and an immunosuppressive microenvironment, etc. Deciphering the pathogenesis of gliomas and finding out the working mechanisms are urgent and necessary for glioma treatment. Identification of prognostic biomarkers and targeting the biomarker genes will be a promising therapy. Methods From our RNA-sequencing data of the oxidative phosphorylation (OXPHOS)-inhibition sensitive and OXPHOS-resistant cell lines, we found that the scaffolding protein caveolin 1 (CAV1) is highly expressed in the resistant group but not in the sensitive group. By comprehensive analysis of our RNA sequencing data, Whole Genome Bisulfite Sequencing (WGBS) data and public databases, we found that CAV1 is highly expressed in gliomas and its expression is positively related with pathological processes, higher CAV1 predicts shorter overall survival. Results Further analysis indicated that (1) the differentiated genes in CAV1-high groups are enriched in immune infiltration and immune response; (2) CAV1 is positively correlated with tumor metastasis markers; (3) the methylation level of CAV1 promoters in glioma group is lower in higher stage than that in lower stage; (4) CAV1 is positively correlated with glioma stemness; (5) higher expression of CAV1 renders the glioma cells’ resistant to oxidative phosphorylation inhibitors. Conclusion Therefore, we identified a key gene CAV1 and deciphered its function in glioma progression and prognosis, proposing that CAV1 may be a therapeutic target for gliomas. Graphical Abstract

High Caveolin-1 mRNA expression in triple-negative breast cancer is associated with an aggressive tumor microenvironment, chemoresistance, and poor clinical outcome

“…The type of PVLs in which CAV1 was highly expressed are also enriched in stem cell markers and platelet-derived growth factor activity [ 40 ]. In glioma and prostate cancer, CAV1 has been implicated as a perquisite for maintaining tumor stemness, where it is known to have a regulatory role in platelet-derived growth factor signaling [ 53 – 55 ]. CAFs enriched for EMT features and myogenesis were associated with CAV1 expression in the single-cell atlas of human breast cancers and the ECOTYPER derived cell states in SCAN-B, [ 40 , 41 ], potentially facilitating metastasis of TNBC.…”

Inflammatory loop involving Staphylococcus aureus, IL-36γ, and cathepsin S drives immunity disorders in familial acne inversa keratinocytes

“…Genes with adjusted P (padj) value < 0.05 were considered differentially expressed. The KOBAS software (Peking University, Beijing, China) was used to explore the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways enriched by differentially expressed genes (DEGs) [ 33 ]. P < 0.05 in the hypergeometric test was considered significant.…”

GNL3L exhibits pro-tumor activities via NF-κB pathway as a poor prognostic factor in acute myeloid leukemia

“…RNA was retrieved from AML cell lines and human samples with Trizol reagent (Invitrogen, Waltham, USA), and then reverse transcribed with SYBR Green qPCR Master Mix for qRT-PCR (TaKaRa, Kusatsu, Japan). RT-PCR was performed according to the standard protocol 31 and the GNL3L-specific signal was amplified using the following primers: GNL3L forward: 5′ATGTGCGAATTCATGATGAAACTTAGACACAAAAATAAAAAGCC and GNL3L reverse: 5′CACCATGATATCCCGGATGAACTTGTCCAGGTAGAC. β-actin was amplified with the following primers: forward: 5′GGCGACGAGGCCCAGA and reverse: 5′CGATTTCCCGCTCGGC as an internal control to normalize the equal quantity of RT products used in PCR.…”