Cation flux through SUR1-TRPM4 and NCX1 in astrocyte endfeet induces water influx through AQP4 and brain swelling after ischemic stroke

Abstract

Brain swelling causes morbidity and mortality in various brain injuries and diseases but lacks effective treatments. Brain swelling is linked to the influx of water into perivascular astrocytes through channels called aquaporins. Water accumulation in astrocytes increases their volume, which contributes to brain swelling. Using a mouse model of severe ischemic stroke, we identified a potentially targetable mechanism that promoted the cell surface localization of aquaporin 4 (AQP4) in perivascular astrocytic endfeet, which completely ensheathe the brain’s capillaries. Cerebral ischemia increased the abundance of the heteromeric cation channel SUR1-TRPM4 and of the Na + /Ca 2+ exchanger NCX1 in the endfeet of perivascular astrocytes. The influx of Na + through SUR1-TRPM4 induced Ca 2+ transport into cells through NCX1 operating in reverse mode, thus raising the intra-endfoot concentration of Ca 2+ . This increase in Ca 2+ stimulated calmodulin-dependent translocation of AQP4 to the plasma membrane and water influx, which led to cellular edema and brain swelling. Pharmacological inhibition or astrocyte-specific deletion of SUR1-TRPM4 or NCX1 reduced brain swelling and improved neurological function in mice to a similar extent as an AQP4 inhibitor and was independent of infarct size. Thus, channels in astrocyte endfeet could be targeted to reduce postischemic brain swelling in stroke patients.

Canagliflozin, an Inhibitor of the Na+-Coupled D-Glucose Cotransporter, SGLT2, Inhibits Astrocyte Swelling and Brain Swelling in Cerebral Ischemia

“…The better neurological function with canagliflozin treatment, despite having no effect on infarct size, underscores the important benefit of reduced brain swelling on neurological function. The reduction in brain swelling with no effect on infarct volume observed here is similar to our recent report with the same model of severe ischemia, in which we evaluated multiple pharmacological treatments and gene deletions targeting SUR1-TRPM4 and NCX1 [28]. In that study, we emphasized the clinical importance of identifying molecularly directed treatments to dissociate brain swelling from infarct size, especially with large infarcts.…”

“…The data presented here and previously [66,67] indicate that SGLT2 inhibitors also have potentially important protective effects in acute ischemic stroke. Moreover, in stroke, our data on SGLT2 as well as previous data on SUR1-TRPM4 and NCX1 [28] indicate that post-ischemic brain swelling is regulated by druggable cellular/molecular mechanisms that are distinct from those that govern neuronal death. Treatments that reduce brain swelling result in better neurological function even without an effect on infarct size, underscoring the clinical importance of targeting mechanisms of brain swelling in cerebral ischemia.…”

“…For series 5 only, in addition to the exclusion criteria listed above, additional prespecified exclusion criteria were death prior to 24 h of reperfusion and infarct volumes < 50 mm 3 . The last criterion resulted in uniformly large infarcts across groups, regardless of treatment, and allowed the study of brain swelling independent of infarct volume [28]. Following MCAo/R, the mice were used as follows: Series 1: Non-diabetic WT mice with MCAo/R (2/6 h) were used for immunohistochemistry (6 mice), RNAScope (3 mice), and the isolation of astrocytes for qPCR and immunoblot (3 mice); 3 uninjured control mice were used for the astrocyte isolation for qPCR and immunoblot.…”

“…Immunoblot for SGLT2 was performed as we described [28,38]. qPCR for Slc5a2 was performed as we described [38,39] using the following primers: (5' to 3 : forward CAGACCTTCGTCATTCTTGCCG; reverse GTGCTGGAGATGTTGC-CAACAG).…”

Brain Swelling versus Infarct Size: A Problematizing Review

“…Our search identified several treatments that had a disproportionate effect on edema/swelling compared to the effect on infarct size ( Table 1 ) and thus might be considered potential candidates for reducing edema independent of infarct size. These included glibenclamide [ 20 , 21 ]; dimethyl fumarate (Tecfidera ® ) [ 22 ] and its metabolite monomethyl fumarate [ 23 ]; soluble programmed death ligand-1 [ 24 ]; and canagliflozin [ 25 ]. All of these drugs reduced edema/swelling without significantly reducing infarct size when administered post-ischemia in MCAo models.…”