CaSpeR5, a family of Drosophila transgenesis and shuttle vectors with improved multiple cloning sites

Le, Tien; Yu, Marcus; Williams, Brandon; Goel, Sagar; Paul, Sarah M.; Beitel, Greg J.

doi:10.2144/000112386

Cited by 19 publications

(17 citation statements)

References 3 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…A sequence ATTATTCTGATTGCGACAATAAATTCCGAT in the TJ 39 UTR was substituted with the sequence CTTAAGCTGATTGCGACAA TAAATACCGGT by overlap PCR to introduce unique AflII and AgeI sites, which were used to insert the inverted EGFP sequence. The modified traffic-jam sequence was transferred into the pCasper5-attB vector (a modified P-element pCaSpeR5 vector [Le et al 2007] with a phiC31 attB site to allow site-specific integration).…”

Section: Cloning and Recombineering-d Melanogastermentioning

confidence: 99%

Production of artificial piRNAs in flies and mice

Muerdter¹,

Olovnikov²,

Molaro³

et al. 2011

RNA

117

View full text Add to dashboard Cite

In animals a discrete class of small RNAs, the piwi-interacting RNAs (piRNAs), guard germ cell genomes against the activity of mobile genetic elements. piRNAs are generated, via an unknown mechanism, from apparently single-stranded precursors that arise from discrete genomic loci, termed piRNA clusters. Presently, little is known about the signals that distinguish a locus as a source of piRNAs. It is also unknown how individual piRNAs are selected from long precursor transcripts. To address these questions, we inserted new artificial sequence information into piRNA clusters and introduced these marked clusters as transgenes into heterologous genomic positions in mice and flies. Profiling of piRNA from transgenic animals demonstrated that artificial sequences were incorporated into the piRNA repertoire. Transgenic piRNA clusters are functional in non-native genomic contexts in both mice and flies, indicating that the signals that define piRNA generative loci must lie within the clusters themselves rather than being implicit in their genomic position. Comparison of transgenic animals that carry insertions of the same artificial sequence into different ectopic piRNA-generating loci showed that both local and long-range sequence environments inform the generation of individual piRNAs from precursor transcripts.

show abstract

Section: Cloning and Recombineering-d Melanogastermentioning

confidence: 99%

Production of artificial piRNAs in flies and mice

Muerdter¹,

Olovnikov²,

Molaro³

et al. 2011

RNA

117

View full text Add to dashboard Cite

show abstract

“…In the first step a 3.3 kb BamHI/Not I fragment from pBPGUw 14 encoding GAL4 and the polyadenylation sequence from the hsp70 gene was cloned into BamHI/Not I sites of pBSC5. 15 In the second step, in PBS, incubated with secondary antibody diluted in PBSTNGS overnight at 4°C, washed 5x two minutes in PBS, before imaging on a Leica TCS-SP confocal microscope. Primary antibodies were rabbit anti-GFP Abfinity mAb (Invitrogen-Cat # G10362; 1:200), Rat anti-HA mAb 3F10 (Roche-Cat # 11 867 423 001; 1:200), and Rabbit anti-TβH.…”

Section: Methodsmentioning

confidence: 99%

An efficient method for recombineering GAL4 and QF drivers

Stowers

2011

fly

View full text Add to dashboard Cite

IntroductionA current challenge in neuroscience is to develop connectomes, maps of the functional connections between neurons in a nervous system. A set of GAL4 and QF drivers specific for neurotransmitters and neurotransmitter receptors would facilitate the development of a Drosophila connectome since knowledge of the neurotransmitter usage of a presynaptic neuron entails knowledge of the neurotransmitter receptor usage of its post-synaptic neuron and vice versa. In Drosophila, many neurotransmitter-specific genes, such as neurotransmitter synthesis enzymes, and most neurotransmitter receptors have extensive conserved noncoding regions (presumably regulatory) that are too large to be contained in traditional plasmid vectors suitable for generating GAL4 and QF drivers. [1][2][3] Therefore, generation of GAL4 and QF drivers that faithfully recapitulate the entire endogenous spatial and temporal expression patterns of neurotransmitter and neurotransmitter receptor-specific genes will require a different type of vector capable of maintaining larger DNA fragments. The recently developed Drosophila genomic CH321 bacterial artificial chromosome (BAC) library has an average insert size of 83 kb 4 and therefore has much greater potential for including in a single clone the complete regulatory region of large Drosophila genes including neurotransmitter synthesis enzymes and neurotransmitter receptors. Since BACs of this size are too large for traditional restriction enzyme cloning, modifying them into GAL4 and QF drivers requires recombineering. In this report an efficient, generally applicable method for recombineering GAL4 and QF cassettes into BACs using kanamycin selection is functionally demonstrated.Neural circuit mapping and manipulation are facilitated by independent control of gene expression in pre-and postsynaptic neurons. the GaL4/Uas and Q binary transcription systems have the potential to provide this capability. Of particular use in neural circuit mapping would be GaL4 and QF drivers specific for neurotransmitters and neurotransmitter receptors. Recently available Drosophila genomic Bac libraries make recombineering large genes including those specific for neurotransmitters and neurotransmitter receptors feasible. here the functionality of cassettes that allow efficient recombineering of GaL4 and QF drivers based on kanamycin selection is demonstrated in Drosophila. the cassettes should, however, be generalizable for recombineering in other species.An efficient method for recombineering GAL4 and QF drivers Keywords: GAL4, QF, recombineering, tyramine beta-hydroxylase, tyramine receptor, bacterial artificial chromosome ResultsOne method for recombineering genes of interest into BACs utilizes a two-step process that involves positive selection for galK in the first step followed by replacement of galK with the gene of interest using negative selection in the second step. 5 Twentytwo BACs from the recently generated Drosophila genomic BAC libraries 4 containing either neurotransmitter synthesis enzymes or neu...

show abstract

“…22 The BglII-ScaI (2,177 bp) genomic fragment comprising both dTaf10 and dTaf10b genes was inserted into the pCaSpeR4 vector. Then, the start codon of either dTaf10 or dTaf10b was substituted with TAG, allowing expression of only one of the two Taf10 genes.…”

Section: Electron Microscopymentioning

confidence: 99%

TAF10 and TAF10b partially redundant roles duringDrosophila melanogastermorphogenesis

et al. 2017

View full text Add to dashboard Cite

Transcription of eukaryotic genes requires the cooperative action of the RNA polymerase complex, the general transcription factors (TFIIB, TFIID, TFIIE, TFIIF and TFIIH) and chromatin modifiers. The TFIID complex contributes to transcriptional activation by several mechanisms and has a subunit with associated histone acetyltransferase (HAT) activity. The histone modifier SAGA complex has both HAT and deubiquitylase (DUB) activities. TFIID and SAGA share several TBP-associated factors (TAFs), but not their HAT subunit. Recently, several duplicated TAF proteins have been identified in higher eukaryotes, but their functional diversity has been so far poorly characterized. Here, we report the functional similarities and differences of TAF10 and TAF10b, the two TAF10 orthologs of Drosophila melanogaster. Results from in silico modeling suggest that dTAF10 and dTAF10b have similar secondary structures characterized by the presence of a histone-fold domain. Additionally, dTAF10 and dTAF10b share interaction partners and show similar expression patterns in neuronal tissues. Nonetheless, dTAF10 and dTAF10b seem to have partly distinct functions. To investigate their roles, we generated dTaf10-dTaf10b double-mutants and rescued the mutant flies with transgenes, which allowed the translation of either dTAF10 or dTAF10b protein. We found that the loss of dTAF10b resulted in pupal lethality, while animals lacking dTAF10 were able to form puparium. dTaf10 mutant adults showed distorted eye morphology. During DNA repair, dTAF10 and dTAF10b act redundantly, suggesting that these proteins have distinct but partially overlapping functions.

show abstract

CaSpeR5, a family of Drosophila transgenesis and shuttle vectors with improved multiple cloning sites

Cited by 19 publications

References 3 publications

Production of artificial piRNAs in flies and mice

Production of artificial piRNAs in flies and mice

An efficient method for recombineering GAL4 and QF drivers

TAF10 and TAF10b partially redundant roles duringDrosophila melanogastermorphogenesis

Contact Info

Product

Resources

About