Calcaridorylaimus castaneae sp. n. (Nematoda, Dorylaimidae) from Bulgaria with an identification key to the species of the genus

Abstract

An unknown species belonging to the genusCalcaridorylaimus Andrássy, 1986 was collected from the litter of broadleaf forests dominated by Castanea sativa Mill. and mixed with Quercus daleshampii Ten. and Fagus sylvatica L. on Belasitsa Mountain, south-western Bulgaria. Calcaridorylaimus castaneae sp. n. is characterised by its long body (1.4–2.1 mm), lip region practically not offset, vulva transverse, short odontostyle (14.5–16 μm) and tail (75.5–110.5 μm, c=14.7–23.6; c’=2.9–4.4) in females and 38–46 μm long spicules with small spur before their distant end in males. It is most similar to C. andrassyi Ahmad & Shaheen, 2004, but differs in having transverse vs pore-like vulva and shorter spicules (38–46 μm vs 52–57 μm). An identification key to the species of the genus Calcaridorylaimus is proposed. Phylogenetic analyses were performed on 18S and D2-D3 expansion domains of 28S rRNA genes by Neighbor-Joining, Maximum Likelihood and Bayesian Inference methods. The phylograms inferred from 18S sequences showed closest relationships of the new species with some species belonging to the genus Mesodorylaimus. However, insufficient molecular data for members of both genera do not allow the phylogenetic relationships of Calcaridorylaimus and the new species described herein to be elucidated.

Description and molecular analysis of Tylencholaimus helanensis sp. n. from China (Dorylaimida, Tylencholaimidea)

“…PCR reactions were performed in a 10 μL reaction mixture containing 5 μL of 2×buffer for KOD FX, 0.3 μL of each primer (10 μM) , 2 μL of dNTPs (200 μM), 1 μL of DNA, 1.2 μL of distilled water and 0.2 μL of KOD FX polymerase (1 U/ μL). Two overlapping fragments of the 18S rDNA were amplified using two primer sets, 988F (5'–CTCAAAGATTAAGCCATGC–3’) and 1912R (5'–TTTACGGTCAGAACTAGGG–3’) for the first fragment, and 1813F (5'–CTGCGTGAGAGGTGAAAT–3’) and 2646R (5'–GCTACCTTGTTACGACTTTT–3’) for the second one (Holterman et al 2006; Nedelchev et al 2014). For the D2-D3 region of the 28S rDNA amplifications, D2A (5’–ACAAGTACCGTGAGGGAAAGTTG–3’) and D3B (5’–TCGGAAGGAACCAGCTACTA–3’) (De Ley et al 1999) were used.…”

“…The sequences of other dorylaimid species and the outgroup taxa were chosen according to previous studies (Holterman et al 2008; Nedelchev et al 2014; Álvarez-Ortega and Peña-Santiago 2016), the sequences of other Tylencholaimus spp. were also included.…”

New data on two remarkable Antarctic species Amblydorylaimus isokaryon (Loof, 1975) Andrássy, 1998 and Pararhyssocolpus paradoxus (Loof, 1975), gen. n., comb. n. (Nematoda, Dorylaimida)

“…n.) Islands. For further details, see Nedelchev et al (2014) . Identical sequences were obtained from both individuals of the same species.…”

“…A BLAST (Basic Local Alignment Search Tool) search at NCBI (National Center for Biotechnology Information) was performed using the obtained sequences as queries to confirm their nematode origin and to identify the most closely related nematode sequences. The sequences revealing highest similarity to newly obtained sequences were included in the phylogenetic analyses of both ribosomal gene regions ( Griffiths et al 2006 ; Holterman et al 2006 ; Meldal et al 2007 ; Lesaulnier et al 2008 ; Pedram et al 2010 ; Pedram et al 2011 ; Álvarez-Ortega and Peña-Santiago 2012a ; 2012b ; Donn et al 2012 ; Álvarez-Ortega et al 2013 ; Nedelchev et al 2014 ).…”

“…Molecular studies of free-living Dorylaimida members are increasing ( Mullin et al 2005 ; Holterman et al 2006 ; 2008 ; Pedram et al 2009 ; 2011 ; Álvarez-Ortega et al 2013a , b , c ; Nedelchev et al 2014 ; Peña-Santiago et al 2015 ). Nevertheless, Antarctic dorylaimids have received little attention in this respect with only one study of this widespread order in Antarctic.…”