Morphometrics and molecular analysis of the free-living nematode, Belondira bagongshanensis n. sp. (Dorylaimida, Belondiridae), from China

Abstract

A new species, Belondira bagongshanensis n. sp., extracted from soil under grass in Bagongshan Forest Park, Anhui Province, China, is described and illustrated. The new species is mainly characterized by a body length 1.6-2.1 mm; cephalic framework moderately sclerotized; odontostyle robust with a distinct lumen; anterior part of pharynx with a distinct fusiform swelling, bearing distinct sclerotized valve plates and basal expansion occupying about three-fifths of the total neck length; female genital system mono-opisthodelphic and anterior branch 0.8-1.6 times the corresponding body diameter; tail short and hemispheroid; male spicules 36-49 μm long and two widely spaced ventromedian supplements. The new species is close to B. wajahati, B. golden and B. eugeniae in possessing a short tail, a robust odontostyle with a distinct aperture and a moderately sclerotized cephalic framework. New sequences of 18S rDNA and the D2-D3 region of 28S rDNA of the new species were also identified.

Three new species, one new genus and subfamily of Dorylaimida (de Man, 1876) Pearse, 1942, and revisions on the families Tylencholaimellidae Jairajpuri, 1964 and Mydonomidae Thorne, 1964 (Nematoda: Dorylaimida)

“…Then, specimens were gently killed at 62 °C for 3 min, fixed in 4% FG fixative, dehydrated using the glycerol-ethanol method and then mounted on permanent slides for further examination (Xie, 2005). The specimens were observed, measured and photographed as described by Wu et al (2017). Locations of the pharyngeal gland nuclei were measured as described previously (Andrássy, 1998).…”

“…For the amplification of D2–D3 region of the 28S rDNA, the primer set D2A (5′–ACAAGTACCGTGAGGGAAAGTTG–3′) and D3B (5′–TCGGAAGGAACCAGCTACTA–3′) (De Ley et al, 1999) were used. The PCR reactions were performed as described previously (Wu et al, 2017). The newly obtained sequences of the new species were deposited in GenBank.…”

Description and molecular analysis of Tylencholaimus helanensis sp. n. from China (Dorylaimida, Tylencholaimidea)

“…For the D2-D3 region of the 28S rDNA amplifications, D2A (5’–ACAAGTACCGTGAGGGAAAGTTG–3’) and D3B (5’–TCGGAAGGAACCAGCTACTA–3’) (De Ley et al 1999) were used. The PCR reactions were carried out as described previously (Wu et al 2017). Electrophoresis was performed on 1% TAE agarose gels and observed under UV transillumination (AlphaImager® EP).…”

Description ofParavulvus zhongshanensissp. nov. (Dorylaimida: Nygolaimidae) from Nanjing, China

“…Leaving aside the plant parasitic forms of the family Longidoridae Thorne, 1935, the study of dorylaims in China is in its infancy despite the great extent of the country and the abundance and diversity of these nematodes. The matter, however, has received more attention in recent years resulting in the discovery of several new and known species in Dorylaimina Pearse, 1936 (Wu et al , 2016, 2017, 2018, 2019) and demonstrating that Chinese dorylaims are likely as diverse as those from other regions of the world. Nygolaims are especially poorly known in China, with only three records, for example, Aquatides aquaticus Thorne, 1930 found in bottom mud of the Baoan Lake in Wuhan of Hubei Province (Wu, 1999), Laevides laevis (Thorne, 1939) Thorne, 1974 found in soil of grassland and bottom mud of the Baoan Lake, but also in soil on the shore of Taiping Lake in Anhui Province and the soil of Xianhua Mountain in Jinhua of Zhejiang Province (Wu, 1999) and Laevides rapax (Thorne, 1939) Ahmad & Jairajpuri, 1982 found in bottom mud of the Poyang Lake in Jiangxi Province and the Baoan Lake in Hubei Province (Wu & Liang, 1997).…”