c-Jun transactivates Puma gene expression to promote osteoarthritis

Abstract

Osteoarthritis (OA) is a chronic degenerative joint disorder in which genetic, hormonal, mechanical and ageing factors affect its progression. Current studies are focusing on chondrocytes as a key mediator of OA at a cellular level. however, the mechanism underlying chondrocyte apoptosis remains unclear. PUMA is a pro-apoptotic member of the BH3-only subgroup of the Bcl-2 family and is involved in a large number of physiological and pathological processes. In the present study, we examined whether PUMA has a role in IL-1β-induced apoptosis and whether the c-Jun N-terminal kinase (JNK)/c-Jun pathway mediates the induction of PUMA, thus contributing to chondrocyte apoptosis. The results demonstrated an increase in PUMA protein and mRNA levels in cultured mouse chondrocytes following 4 h of IL-1β treatment. Furthermore, this upregulation of PUMA was critical for chondrocyte apoptosis as knockdown of PUMA using PUMA-specific siRNA significantly reduced apoptosis in cultured cells. Upon pharmacological inhibition of the JNK/c-Jun pathway with CE11004 or SP600125, the expression of PUMA was notably suppressed with a concomitant decrease in apoptosis observed in IL-1β-treated chondrocytes. Also, immunohistochemical studies revealed that the PUMA and c-Jun proteins were upregulated in chondrocytes from the articular cartilage of OA patients. Together, these data suggest a role for PUMA and the JNK/c-Jun pathway in the regulation of chondrocyte apoptosis during OA.

Vitamin E synthetic derivate—TPGS—selectively induces apoptosis in jurkat t cells via oxidative stress signaling pathways: implications for acute lymphoblastic leukemia

“…It has also been demonstrated that ASK1 activity is inhibited through its interaction with thioredoxin and that oxidation of (Cys 32 , Cys 35 thiol residues) of thioredoxin (Trx) in response to H 2 O 2 disrupts this interaction, thereby resulting in ASK1 activation [41]. In agreement with Lu and co-workers [42], our immunohistochemistry studies have revealed that Then after, cells were stained with Hoechst dye (a 0 -j 0 ) and anti-p53 (a 00 , b 00 ), anti-c-Jun (c 00 , d 00 ), anti-Bax (e 00 , f 00 ), anti-Caspase 3 (g 00 , h 00 ), and anti-DJ-1 (i 00 -j 00 ).…”

Idelalisib induces PUMA-dependent apoptosis in colon cancer cells

“…The control scrambled siRNA and siRNA for human p65 (sc-29410), and GSK3β (sc-35527) were from Santa Cruz Biotechnology. For stable transfection a shRNA-expressing plasmid that containing the p53-targeting sequence (CACCATCCACTACAACTACAT) [39], PUMA- targeting sequence (CCTGGAGGGTCATGTACAATCTC TT) [40], or a vector containing a scrambled sequence was transfected into HCT116 cells, followed transfection, cells were plated in 96-well plates in the presence of 5 μg/mL puromycin. The protein expression of puromycin-resistant clones was then analyzed by western blotting.…”

Inflammatory biomarkers in osteoarthritis

“…The injury of articular cartilage induces changes in genes associated with cell signaling, response to injury, and wound healing(22). Recently, the pro-apoptotic gene, PUMA, has been shown to be activated by the c-Jun N-terminal kinase (JNK)/c-Jun pathway in the regulation of chondrocyte apoptosis in cartilage of patients with OA(23). Moreover, the Wnt signaling pathway, which is involved in both cartilage and bone tissue homeostasis(24), was found to be up-regulated while its inhibitor (FRZB) was down-regulated in cartilage from joints with moderate to severe OA damage(22).…”