Biosynthesis and functions of bacillithiol, a major low-molecular-weight thiol in Bacilli

Abstract

Bacillithiol (BSH), the α-anomeric glycoside of L-cysteinyl-D-glucosamine with L-malic acid, is a major low-molecular-weight thiol in Bacillus subtilis and related bacteria. Here, we identify genes required for BSH biosynthesis and provide evidence that the synthetic pathway has similarities to that established for the related thiol (mycothiol) in the Actinobacteria. Consistent with a key role for BSH in detoxification of electrophiles, the BshA glycosyltransferase and BshB1 deacetylase are encoded in an operon with methylglyoxal synthase. BshB1 is partially redundant in function with BshB2, a deacetylase of the LmbE family. Phylogenomic profiling identified a conserved unknown function protein (COG4365) as a candidate cysteine-adding enzyme (BshC) that cooccurs in genomes also encoding BshA, BshB1, and BshB2. Additional evolutionarily linked proteins include a thioredoxin reductase homolog and two thiol:disulfide oxidoreductases of the DUF1094 (CxC motif) family. Mutants lacking BshA, BshC, or both BshB1 and BshB2 are devoid of BSH. BSH is at least partially redundant in function with other low-molecular-weight thiols: redox proteomics indicates that protein thiols are largely reduced even in the absence of BSH. At the transcriptional level, the induction of genes controlled by two thiol-based regulators (OhrR, Spx) occurs normally. However, BSH null cells are significantly altered in acid and salt resistance, sporulation, and resistance to electrophiles and thiol reactive compounds. Moreover, cells lacking BSH are highly sensitive to fosfomycin, an epoxidecontaining antibiotic detoxified by FosB, a prototype for bacillithiol-Stransferase enzymes.Bacillus subtilis | glutathione | glutaredoxin | mycothiol | thioredoxin

Regulation of Bacillus subtilis bacillithiol biosynthesis operons by Spx

“…Bacilli, Staphylococcus aureus) and Deinococcus radiodurans (Newton et al, 2009. BSH is involved in the resistance to several different stress conditions (Gaballa et al, 2010) including exposure to bleach (hypochlorous acid) which leads to protein bacillithiolation (Chi et al, 2011(Chi et al, , 2013. BSH also participates directly in the chemical detoxification of thiolreactive compounds such as monobromobimane and antibiotics such as rifamycin and fosfomycin (Antelmann & Helmann, 2011;Gaballa et al, 2010;Sharma et al, 2011).…”

“…BSH is involved in the resistance to several different stress conditions (Gaballa et al, 2010) including exposure to bleach (hypochlorous acid) which leads to protein bacillithiolation (Chi et al, 2011(Chi et al, , 2013. BSH also participates directly in the chemical detoxification of thiolreactive compounds such as monobromobimane and antibiotics such as rifamycin and fosfomycin (Antelmann & Helmann, 2011;Gaballa et al, 2010;Sharma et al, 2011). CATGACTCGGTCGTGAGCT 59RACE for ypjD ypjD-gsp2 ACAAACCAATACAAATAGCACAT 59RACE for ypjD yojE-GSP1 AGAGCGCAACTCCTGCCAT 59RACE for yojE yojE-GSP2 ACCATATAATACGATGAGCCAA 59RACE for yojE yoyC-GPS1 GTTCGAGCTGTGAATTCACAAT 59RACE for yoyC yoyC-GPS2 TCAATCGCCTCTGCTACCG 59RACE for yoyC ylbQ-gsp1 GCAATCAGCCCTGAATTCCT 59RACE for ylbQ ylbQ-gsp2 CCGGATTCCTTCAGACTGAA 59RACE for ylbQ yllA-Gps1 CGCCAATTCCTCTCTTGCGA 59RACE for bshC yllA-Gps2 GGAAGATAAGTCTTCCAGTCT 59RACE for bshC ypjD-RT-dapB-F GACTGAAGATGATAAAAGCATGGAA rtPCR for ypjD-dapB overlap ypjD-RT-dapB-R ATTTAACAGCTTCCTGCCCCATT rtPCR for ypjD-dapB overlap dapB-RT-mgsA-F CATGAAGATTGATCAGCTTGTGTAT rtPCR for dapB-mgsA overlap dapB-RT-mgsA-R TTGAAGACCTGTCGCCTCATGA rtPCR for dapB-mgsA overlap mgsA-RT-ypjG -F TGCGGAAATTCTTGTGCGCACA rtPCR for mgsA-bshB1 overlap mgsA-RT-ypjG -R GAAGAGAGTTCCGCTTCTGTCA rtPCR for mgsA-bshB1 overlap ypjG-RT-ypjH-F TAAAGAAGCGGGCGTGGAGTAT rtPCR for bshB1-bshA overlap ypjG-RT-ypjH-R AATGCTTGATGTGATGAAATGGATT rtPCR for bshB1-bshA overlap ypjH-RT-cca-F AAGATGAACAGCTAAGCAATCGTT rtPCR for bshA-cca overlap ypjH-RT-cca-R CGTTTCATATAGCTGTCACGAACT rtPCR for bshA-cca overlap cca-RT-birA-F AAATGGGTGTCAGAAGAATTACAGT rtPCR for cca-birA overlap cca-RT-birA-R CAATATGCTTCCACACAGCAGTT rtPCR for cca-birA overlap ypjD-lacZ-locus-F GCGaagctTAGACCGTTACATAGGCCAAT Construction of HB11100 ypjD-lacZ-locus-R CGCggaTCCTCTTCCATGCTTTTATCAT Construction of HB11100 yojG-North-F CTGATATCATGGAAGAGATCAT Northern analysis of bshB2 yojG-North-R GCTCTCTGAGCATGCCTTC Northern analysis of bshB2 ylla-pmutin-F GCGaagcTTCATCATAAGGACATGTGGC Construction of HB11205…”

“…1) begins with the coupling of UDP-N-acetylglucosamine (UDP-GlcNAc) and L-malate to produce a-D-glucosaminyl L-malate (GlcNAc-Mal). This step is catalysed by BshA (N-acetyl-a-D-glucosaminyl L-malate synthase), which is a homologue of the Mycobacterium tuberculosis glycosyltransferase MshA (Gaballa et al, 2010;Newton et al, 2003;Parsonage et al, 2010;Upton et al, 2012). The second step is deacetylation of GlcNAc-Mal to produce GlcN-Mal.…”

“…The second step is deacetylation of GlcNAc-Mal to produce GlcN-Mal. The deacetylation can be carried out in B. subtilis by either of two redundant enzymes, BshB1, encoded by the gene upstream from bshA, or BshB2 (Gaballa et al, 2010). The last step of BSH biosynthesis is achieved by coupling Cys to GlcN-Mal, and requires the product of the bshC gene (Gaballa et al, 2010).…”

“…The deacetylation can be carried out in B. subtilis by either of two redundant enzymes, BshB1, encoded by the gene upstream from bshA, or BshB2 (Gaballa et al, 2010). The last step of BSH biosynthesis is achieved by coupling Cys to GlcN-Mal, and requires the product of the bshC gene (Gaballa et al, 2010). Unlike M. tuberculosis MshC, which is a Cys-ligase related to cysteinyl-tRNA synthetase (Sareen et al, 2002), BshC is a large protein with no obvious homologues and no identifiable domains.…”