Chemical and Chemoenzymatic Syntheses of Bacillithiol: A Unique Low‐Molecular‐Weight Thiol amongst Low G + C Gram‐Positive Bacteria

Sharma, Sunil V.; Jothivasan, Vishnu Karthik; Newton, Gerald L.; Upton, Heather; Wakabayashi, Judy I.; Kane, Melissa G.; Roberts, A. W.; Rawat, Mamta; Clair, James J. La; Hamilton, Chris J.

doi:10.1002/ange.201100196

Cited by 15 publications

(23 citation statements)

References 26 publications

(27 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Analysis of the FosA/FosB sequence alignments indicates several amino acid residues that are not found in FosA, but are conserved among the four FosB enzymes that have been shown to recognize BSH as a substrate [21,37] (Figure 8C). The fosfomycin-bound Ba FosB ( B. anthracis FosB) structure reveals how several of these amino acids (Asn 50 , Tyr 127 and Tyr 128 , as well as the Arg 94 , Asp 97 and Asp 100 residues of a conserved G R XR D XR D motif) line the active site in proximity to where BSH must bind in order to conjugate with fosfomycin (Figures 8A and 8B).…”

Section: Resultsmentioning

confidence: 99%

“…BSH was chemically synthesized as described previously [21]. Cysteine, N -acetylcysteine, GSH, homocysteine, γ-Glu-Cys (γ-glutamylcysteine) and CoA were purchased from Sigma–Aldrich.…”

Section: Methodsmentioning

confidence: 99%

“…In B. subtilis , this increased fosfomycin sensitivity was comparable with that observed in the fosB mutant and in a double mutant for both fosB and BSH biosynthesis, which suggested that FosB utilizes BSH as its native thiol substrate [19]. A total chemical synthesis of BSH [21] recently provided sufficient material for preliminary activity assays, which, at fixed thiol substrate concentrations (1 mM), demonstrated S. aureus FosB ( Sa FosB) to be significantly more active with BSH than cysteine. This supported further the notion of FosB being a bacillithiol-S-transferase.…”

Section: Introductionmentioning

confidence: 94%

See 2 more Smart Citations

Mechanistic studies of FosB: a divalent-metal-dependent bacillithiol-S-transferase that mediates fosfomycin resistance in Staphylococcus aureus

Roberts

Sharma

Strankman

et al. 2013

Biochemical Journal

Self Cite

105

View full text Add to dashboard Cite

FosB is a divalent-metal-dependent thiol-S-transferase implicated in fosfomycin resistance among many pathogenic Gram-positive bacteria. In the present paper, we describe detailed kinetic studies of FosB from Staphylococcus aureus (SaFosB) that confirm that bacillithiol (BSH) is its preferred physiological thiol substrate. SaFosB is the first to be characterized among a new class of enzyme (bacillithiol-S-transferases), which, unlike glutathione transferases, are distributed among many low-G + C Gram-positive bacteria that use BSH instead of glutathione as their major low-molecular-mass thiol. The Km values for BSH and fosfomycin are 4.2 and 17.8 mM respectively. Substrate specificity assays revealed that the thiol and amino groups of BSH are essential for activity, whereas malate is important for SaFosB recognition and catalytic efficiency. Metal activity assays indicated that Mn2+ and Mg2+ are likely to be the relevant cofactors under physiological conditions. The serine analogue of BSH (BOH) is an effective competitive inhibitor of SaFosB with respect to BSH, but uncompetitive with respect to fosfomycin. Coupled with NMR characterization of the reaction product (BS– fosfomycin), this demonstrates that the SaFosB-catalysed reaction pathway involves a compulsory ordered binding mechanism with fosfomycin binding first followed by BSH which then attacks the more sterically hindered C-1 carbon of the fosfomycin epoxide. Disruption of BSH biosynthesis in S. aureus increases sensitivity to fosfomycin. Together, these results indicate that SaFosB is a divalent-metal-dependent bacillithiol-S-transferase that confers fosfomycin resistance on S. aureus.

show abstract

Section: Resultsmentioning

confidence: 99%

“…BSH was chemically synthesized as described previously [21]. Cysteine, N -acetylcysteine, GSH, homocysteine, γ-Glu-Cys (γ-glutamylcysteine) and CoA were purchased from Sigma–Aldrich.…”

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 94%

See 1 more Smart Citation

Mechanistic studies of FosB: a divalent-metal-dependent bacillithiol-S-transferase that mediates fosfomycin resistance in Staphylococcus aureus

Roberts

Sharma

Strankman

et al. 2013

Biochemical Journal

Self Cite

105

View full text Add to dashboard Cite

show abstract

“…BSH is involved in the resistance to several different stress conditions (Gaballa et al, 2010) including exposure to bleach (hypochlorous acid) which leads to protein bacillithiolation (Chi et al, 2011(Chi et al, , 2013. BSH also participates directly in the chemical detoxification of thiolreactive compounds such as monobromobimane and antibiotics such as rifamycin and fosfomycin (Antelmann & Helmann, 2011;Gaballa et al, 2010;Sharma et al, 2011). CATGACTCGGTCGTGAGCT 59RACE for ypjD ypjD-gsp2 ACAAACCAATACAAATAGCACAT 59RACE for ypjD yojE-GSP1 AGAGCGCAACTCCTGCCAT 59RACE for yojE yojE-GSP2 ACCATATAATACGATGAGCCAA 59RACE for yojE yoyC-GPS1 GTTCGAGCTGTGAATTCACAAT 59RACE for yoyC yoyC-GPS2 TCAATCGCCTCTGCTACCG 59RACE for yoyC ylbQ-gsp1 GCAATCAGCCCTGAATTCCT 59RACE for ylbQ ylbQ-gsp2 CCGGATTCCTTCAGACTGAA 59RACE for ylbQ yllA-Gps1 CGCCAATTCCTCTCTTGCGA 59RACE for bshC yllA-Gps2 GGAAGATAAGTCTTCCAGTCT 59RACE for bshC ypjD-RT-dapB-F GACTGAAGATGATAAAAGCATGGAA rtPCR for ypjD-dapB overlap ypjD-RT-dapB-R ATTTAACAGCTTCCTGCCCCATT rtPCR for ypjD-dapB overlap dapB-RT-mgsA-F CATGAAGATTGATCAGCTTGTGTAT rtPCR for dapB-mgsA overlap dapB-RT-mgsA-R TTGAAGACCTGTCGCCTCATGA rtPCR for dapB-mgsA overlap mgsA-RT-ypjG -F TGCGGAAATTCTTGTGCGCACA rtPCR for mgsA-bshB1 overlap mgsA-RT-ypjG -R GAAGAGAGTTCCGCTTCTGTCA rtPCR for mgsA-bshB1 overlap ypjG-RT-ypjH-F TAAAGAAGCGGGCGTGGAGTAT rtPCR for bshB1-bshA overlap ypjG-RT-ypjH-R AATGCTTGATGTGATGAAATGGATT rtPCR for bshB1-bshA overlap ypjH-RT-cca-F AAGATGAACAGCTAAGCAATCGTT rtPCR for bshA-cca overlap ypjH-RT-cca-R CGTTTCATATAGCTGTCACGAACT rtPCR for bshA-cca overlap cca-RT-birA-F AAATGGGTGTCAGAAGAATTACAGT rtPCR for cca-birA overlap cca-RT-birA-R CAATATGCTTCCACACAGCAGTT rtPCR for cca-birA overlap ypjD-lacZ-locus-F GCGaagctTAGACCGTTACATAGGCCAAT Construction of HB11100 ypjD-lacZ-locus-R CGCggaTCCTCTTCCATGCTTTTATCAT Construction of HB11100 yojG-North-F CTGATATCATGGAAGAGATCAT Northern analysis of bshB2 yojG-North-R GCTCTCTGAGCATGCCTTC Northern analysis of bshB2 ylla-pmutin-F GCGaagcTTCATCATAAGGACATGTGGC Construction of HB11205…”

Section: Introductionmentioning

confidence: 99%

“…Unlike M. tuberculosis MshC, which is a Cys-ligase related to cysteinyl-tRNA synthetase (Sareen et al, 2002), BshC is a large protein with no obvious homologues and no identifiable domains. BSH has been synthesized using both chemical and chemoenzymic approaches (Antelmann & Helmann, 2011;Lamers et al, 2012;Sharma et al, 2011).…”

Section: Introductionmentioning

confidence: 99%

Regulation of Bacillus subtilis bacillithiol biosynthesis operons by Spx

et al. 2013

Self Cite

View full text Add to dashboard Cite

Bacillithiol is the major low molecular mass thiol produced by many firmicutes bacteria, including the model organism Bacillus subtilis and pathogens such as Bacillus anthracis and Staphylococcus aureus. We have previously shown that four genes (bshA, bshB1, bshB2 and bshC) are involved in bacillithiol biosynthesis. Here, we report that these four genes are encoded within three, unlinked operons all expressed from canonical s A -dependent promoters as determined by 59RACE (rapid amplification of cDNA ends). The bshA and bshB1 genes are embedded within a seven-gene operon additionally including mgsA, encoding methylglyoxal synthase, and the essential genes cca and birA, encoding tRNA nucleotidyltransferase (CCA transferase) and biotin-protein ligase, respectively. The bshB2 gene is co-transcribed with unknown function genes, while bshC is expressed both as part of a two-gene operon (with the upstream putative pantothenate biosynthesis gene ylbQ) and from its own promoter. All three operons are expressed at a reduced level in an spx null mutant, consistent with a direct role of Spx as a transcriptional activator for these operons, and all three operons are induced by the thiol oxidant diamide. In contrast with other Spx-regulated genes characterized to date, the effects of Spx on basal expression and diamide-stimulated expression appear to be independent of Cys10 in the redox centre of Spx. Consistent with the role of Spx as an activator of bacillithiol biosynthetic genes, cellular levels of bacillithiol are reduced several-fold in an spx null mutant.

show abstract