Biological and molecular characterization of a recombinant isolate of Watermelon mosaic virus associated with a watermelon necrotic disease in Italy

Abstract

The biological and molecular characterization\ud is reported of a Watermelon mosaic virus isolate,\ud denoted WMV-Le, associated with a necrotic phenotype\ud of watermelon plants grown in the Provinces of\ud Lecce and Taranto (Apulia, southern Italy). The fully\ud sequencedWMV-Le genome consists of 10,045 nucleotides\ud and is 99.1% similar to that of WMV-C05-270, a\ud French isolate from melon of the WMV molecular\ud group 3. Using recombination detection programRDP3,\ud putative recombination breakpoints were identified\ud close to nucleotide positions 42 to 1892, covering the\ud 5′UTR/P1/HC-Pro region. The event represents the\ud insertion of a sequence fragment of an isolate similar to\ud WMV-FBR04-37 in the background of an isolate similar\ud to WMV-FMF00-LL1. The field symptomatology was\ud reproduced in watermelon plants grown in an experimental\ud greenhouse but the virus induced severe symptoms\ud also in Cucumis sativus, C. melo, Cucurbita\ud maxima and C. pepo

First detection of tomato leaf curl New Delhi virus in melon and zucchini squash in southern Italy

“…Disease incidence in the three crops was close to 100%. Symptoms resembled those described recently for infections of tomato leaf curl New Delhi virus (ToLCNDV) (Panno et al, 2016) and watermelon mosaic virus (WMV) (Finetti-Sialer et al, 2012). DNA and RNA preparations from two plants for each species were tested by PCR, respectively, with primers For-5'CCCTTGTAAAGTGCAGTCCT3' and Rev-5'GGATTTGATGCGTGAGTACA3' for the AV1 gene of ToLCNDV DNA-A and with primers For-5'AAACTGGG CAGGGTAGCA3' and Rev-5'TAACCTGCTGTTAA YCCCGCG3' for the WMV coat protein gene.…”

IDENTIFICATION AND EFFECTS OF MIXED INFECTION OF Potyvirus ISOLATES WITH Cucumber mosaic virus IN CUCURBITS

“…Predominant viral species include those of the Potyvirus genus(family Potyviridae), such as Papaya ringspot virus type Watermelon (PRSV-W), Watermelon mosaic virus (WMV), and Zucchini yellow mosaic virus (ZYMV) (FINETTI-SIALER et al, 2012;LIMA et al, 2015). The infection incidence with these viruses is high and they can occur as single or mixed infections with other virus species, including Cucumber mosaic virus (CMV; Cucumovirus genus).…”

Detection of natural infection by <i>Cucumber mosaic virus</i> in vegetable crops

“…Long-term storage of CMV is most reliable in the form of viral RNA which is highly infectious and very stable at -20 °C [9]. A great number of different CMV strains, serogroups, subgroups and biological variations has been described [5,[10][11][12][13][14]. The numerous serological isolates, instability of CMV particles and a comparatively poor immunological response comprise difficulties in the serological identification of CMV.…”