Binge‐like ethanol drinking activates anaplastic lymphoma kinase signaling and increases the expression of STAT3 target genes in the mouse hippocampus and prefrontal cortex

Abstract

Alcohol use disorder (AUD) has a complex pathogenesis, making it a difficult disorder to treat. Identifying relevant signaling pathways in the brain may be useful for finding new pharmacological targets to treat AUD. The receptor tyrosine kinase anaplastic lymphoma kinase (ALK) activates the transcription factor STAT3 in response to ethanol in cell lines. Here, we show ALK activation and upregulation of known STAT3 target genes (Socs3, Gfap and Tnfrsf1a) in the prefrontal cortex (PFC) and ventral hippocampus (HPC) of mice after 4 days of binge‐like ethanol drinking. Mice treated with the STAT3 inhibitor stattic drank less ethanol than vehicle‐treated mice, demonstrating the behavioral importance of STAT3. To identify novel ethanol‐induced target genes downstream of the ALK and STAT3 pathway, we analyzed the NIH LINCS L1000 database for gene signature overlap between ALK inhibitor (alectinib and NVP‐TAE684) and STAT3 inhibitor (niclosamide) treatments on cell lines. These genes were then compared with differentially expressed genes in the PFC of mice after binge‐like drinking. We found 95 unique gene candidates, out of which 57 had STAT3 binding motifs in their promoters. We further showed by qPCR that expression of the putative STAT3 genes Nr1h2, Smarcc1, Smarca4 and Gpnmb were increased in either the PFC or HPC after binge‐like drinking. Together, these results indicate activation of the ALK‐STAT3 signaling pathway in the brain after binge‐like ethanol consumption, identify putative novel ethanol‐responsive STAT3 target genes, and suggest that STAT3 inhibition may be a potential method to reduce binge drinking in humans.

Effect of a brain‐penetrant selective estrogen receptor degrader (SERD) on binge drinking in female mice

“…Drinking in the dark was conducted as described (Coles & Lasek, 2021; Hamada et al, 2021). Briefly, mice were given access to a sipper tube containing 20% EtOH or water, 3 h into the dark cycle for 2 h on the first 3 days, and 4 h on the 4th day.…”

“…For measuring Esr1 gene expression by qPCR after DID with water or EtOH, both male and female mice (nine mice per sex per group) were used. Brain samples were those from previously published experiments (Coles & Lasek, 2021; Hamada et al, 2021). Drinking levels and BECs can be found in those studies.…”

“…qPCR was performed using SYBR green PCR master mix (Bio‐Rad) with primers to mouse Esr1 (forward, 5′‐CCTACTACCTGGAGAACGAGC‐3′, reverse, 5′‐GCACAGTAGCGAGTCTCCTT‐3′). Relative mRNA levels were determined using the method using the reference genes Hprt and Rpl13a (Hamada et al, 2021). Data are shown normalized to Rpl13a , as the results did not differ when normalization was done with either reference gene.…”

“…Prefrontal cortex (PFC) and ventral hippocampus (vHPC) samples were the same as those reported in Hamada et al (2021), and VTA samples were the same as those reported in Coles and Lasek (2021). Total RNA was extracted from brain samples using the RNeasy Mini kit (QIAGEN) according to the manufacturer's instructions and reverse transcribed using the High-Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific).…”

Drosophila Stat92E Signaling Following Pre-exposure to Ethanol

“…Recently, the Janus kinase (JAK)/Signal transducer and activator of transcription (STAT) signaling pathway was implicated in both Drosophila and mammalian models of AUD. 6 - 8 JAK/STAT signaling is widely studied in the context of development and innate immune signaling, 9 but it is unclear how STAT activity in the brain and alcohol-associated behavior are impacted after repeated ethanol exposure.…”