Beneficial effect of farnesoid X receptor activation on metabolism in a diabetic rat model

Abstract

Farnesoid X receptor (FXR) is an important regulator of glucose and lipid homeostasis. However, the exact role of FXR in diabetes remains to be fully elucidated. The present study examined the effects of chenodeoxycholic acid (CDCA), an agonist of FXR, on metabolism profile in a rat model of type 2 diabetes mellitus (T2DM). Male Wistar rats (8‑week‑old; n=40) were randomized into the following four groups (n=10): Untreated control, CDCA‑treated, T2DM, and CDCA‑treated T2DM. To establish the T2DM model, the rats were fed a high‑fat diet (HFD) for 4 weeks and received a single low‑dose intraperitoneal injection of streptozotocin (30 mg/kg), followed by an additional 4 weeks of HFD feeding. CDCA was administrated (10 mg/kg/d) intraperitoneally for 10 days. Reverse transcription‑quantitative polymerase chain reaction and western blotting assays were performed to determine the RNA and protein expression of FXR, phosphoenolpyruvate carboxykinase, G6Pase, proliferator‑activated receptor‑γ coactivator‑1 and short heterodimer partner in rat liver tissue. The results revealed that FXR activation by CDCA did not reduce body weight, but it lowered the plasma levels of fasting glucose, insulin and triglycerides in the T2DM rats. CDCA administration reversed the downregulation of the mRNA and protein expression of FXR in the T2DM rat liver tissue samples. Furthermore, treatment with CDCA reduced the mRNA and protein expression levels of phosphoenolpyruvate carboxykinase, glucose 6‑phosphatase and peroxisome proliferator‑activated receptor‑γ coactivator‑1 in the liver tissue samples of the T2DM rats. By contrast, CDCA treatment increased the mRNA and protein expression levels of short heterodimer partner in the liver tissue samples of the T2DM rats. In conclusion, FXR agonist treatment induces beneficial effects on metabolism in the rat T2DM model. In conclusion, the present study indicated that the FXR agonist may be useful for the treatment of T2DM and hypertriglyceridemia.

Chenodeoxycholic Acid Ameliorates AlCl3-Induced Alzheimer’s Disease Neurotoxicity and Cognitive Deterioration via Enhanced Insulin Signaling in Rats

“…Despite the scarcity of data about the role of CDCA in CNS, yet in the periphery, a 2016 study by Zhang et al [30] reported that improved insulin sensitivity was achieved through CDCA agonistic activity to FXR. In addition, CDCA was found to upregulate the expression of GLUT4, which was suggested to be mediated through FXR binding to GLUT4-FXR response element (FXRE) in the GLUT4 promoter; thus, indicating that FXR is a new transcription factor for GLUT4 and highlighting the role of FXR and its agonists in insulin sensitivity and glucose homeostasis [31].…”

Mechanistic evaluation of AMPK/SIRT1/FXR signaling axis, inflammation, and redox status in thioacetamide‐induced liver cirrhosis: The role ofCichorium intybuslinn (chicory)‐supplemented diet

“…FXR mRNA transcript was measured relative to the housekeeping gene, β‐actin, which was used as an internal control. Sequence‐specific primers were designed as follows (Zhang et al, ): rat FXR forward primer (5′‐GCGAAAGTGCTGGGCTTTG‐3′) and reverse primer (5′‐TGTGCTTCTGGGATGGTGGT‐3′) (GenBank Accession No. NM_021745.1); rat β‐actin forward primer (5′‐CGTTGACATCCGTAAAGACCTC‐3′) and reverse primer (5′‐TAGGAGCCAGGGCAGTAATCT‐3′) (GenBank Accession No.…”

Gut microbiota: a promising target against cardiometabolic diseases

“…CDCA functions as a FXR agonist and administration of CDCA in a rat T2DM model reduced insulin and triglyceride levels but did not reduce body weight while FXR gene expression in the liver was increased [87]. However, the other major bile acid signaling receptor, TGR5, could have also mediated this effect but this was not tested in this study [85,87]. In a mouse model, bacterial bile acid modification in the gut modulated lipid metabolism and contributed to weight gain in the host [88].…”

“…Activation of the nuclear receptor FXR has been associated with beneficial effects on metabolism such as reduction of body weight and inflammatory markers in mice [86]. CDCA functions as a FXR agonist and administration of CDCA in a rat T2DM model reduced insulin and triglyceride levels but did not reduce body weight while FXR gene expression in the liver was increased [87]. However, the other major bile acid signaling receptor, TGR5, could have also mediated this effect but this was not tested in this study [85,87].…”

“…As UDCA is already approved to treat primary biliary cholangitis by the U.S. Food and Drug Administration for humans, usage of this drug is an attractive option as experience in humans with this compound already exists [142]. Another attractive target is FXR, which is involved in the regulation of glucose and lipid metabolism [87]. Administration of the selective FXR receptor agonist Fexeramine reduced systemic inflammation, hepatic glucose production, and diet-induced weight gain while promoting browning of white adipose tissue and thermogenesis in mice [86].…”