BCL2L12 is a Novel Biomarker for the Prediction of Short-Term Relapse in Nasopharyngeal Carcinoma

Abstract

BCL2-like 12 (BCL2L12 ) is a new member of the apoptosis-related BCL2 gene family, members of which are implicated in various malignancies. Nasopharyngeal carcinoma is a highly metastatic, malignant epithelial tumor, with a high prevalence in Southeast Asia and North Africa. The purpose of the current study was to quantify and investigate the expression levels of the BCL2L12 gene in nasopharyngeal carcinoma biopsies and to assess its prognostic value. Total RNA was isolated from 89 malignant and hyperplastic nasopharyngeal biopsies from Tunisian patients. After testing the quality of the extracted RNA, cDNA was prepared by reverse transcription. A highly sensitive real-time polymerase chain reaction (PCR) method for BCL2L12 mRNA quantification was developed using SYBR ® Green chemistry. GAPDH served as a reference gene. Relative quantification analysis was performed using the comparative C T (2 -ΔΔCT ) method. Higher BCL2L12 mRNA levels were detected in undifferentiated carcinomas of the nasopharynx, rather than in nonkeratinizing nasopharyngeal tumors (P = 0.045). BCL2L12 expression status was also found to be positively associated with the presence of distant metastases (P = 0.014). Kaplan-Meier survival analysis demonstrated that patients with BCL2L12-positive nasopharyngeal tumors have significantly shorter disease-free survival (P = 0.020). Cox regression analysis showed BCL2L12 expression to be an unfavorable and independent prognostic indicator of short-term relapse in nasopharyngeal carcinoma (P = 0.042). Our results suggest that mRNA expression of BCL2L12 may constitute a novel biomarker for the prediction of short-term relapse in nasopharyngeal carcinoma.

Quantitative expression analysis of the apoptosis‐related gene, BCL2L12, in head and neck squamous cell carcinoma

“…Expression analysis of BCL2L12 uncovered its prognostic potential in various malignancies, including breast (13, 14), colon (11, 12), and gastric cancer (15). According to our recently published data, BCL2L12 can be considered as a novel biomarker for the prediction of short‐term relapse in NPC, as its mRNA expression is an unfavorable and independent prognostic indicator of DFS in NPC patients (17).…”

“…The sequences of the BCL2L12 real‐time PCR primers were: 5′‐CCCTCGGCCTTGCTCTCT‐3′ and 5′‐TCCGCAGTATGGCTTCCTTC‐3′, producing a 182‐bp PCR amplicon with a T m of 84.5°C, while the sequences of the GAPDH real‐time PCR primers were the following: 5′‐ATGGGGAAGGTGAAGGTCG‐3′ and 5′‐GGGTCATTGATGGCAACAATATC‐3′, resulting in a 107‐bp PCR amplicon with a T m of 79.4°C. Quantitative real‐time PCR was performed in a 7500 Real‐Time PCR System (Applied Biosystems, Foster City, CA, USA) using the SYBR ® Green chemistry (Applied Biosystems), and dissociation curves of the PCR products were generated after amplification, as previously described (17), to distinguish between the main PCR products and primer‐dimers or other non‐specific products. Each real‐time PCR was performed in duplicate, to evaluate data reproducibility.…”

“…Furthermore, BCL2L12 mRNA expression has recently been linked to unfavorable prognosis in nasopharyngeal carcinoma (NPC) and has been suggested as a novel, useful tissue biomarker for the prediction of NPC patients’ short‐term relapse. Interestingly, BCL2L12 overexpression may also account for the resistance of NPC patients with advanced‐stage disease to chemotherapeutic and irradiation treatment (17).…”

Molecular cloning of novel alternatively spliced variants of BCL2L12, a new member of the BCL2 gene family, and their expression analysis in cancer cells

“…useful tissue biomarker for the prediction of NPC patients' short-term relapse. It is worth mentioning that BCL2L12 overexpression may also account for resistance of NPC patients with advanced-stage disease to chemotherapeutic and irradiation treatment (Fendri et al, 2011).…”

Quantitative expression analysis and prognostic significance of the BCL2-associated Xgene in nasopharyngeal carcinoma: a retrospective cohort study

“…According to our previously published results, BCL2L12 mRNA expression is also associated with unfavorable prognosis in NPC patients and may represent a novel molecular biomarker for the prediction of short-term relapse in NPC. Moreover, BCL2L12 overexpression is likely to account for resistance of NPC patients with advanced-stage disease to chemotherapeutic and irradiation treatment [58]. …”