Bacteriophages as Templates for Manufacturing Supramolecular Structures

Abstract

SS phages are genetically enginnered by replacing 2 N-terminal amino acids of the p8 coat protein of the fd phage. AGE and zeta potential measurements show that SS phages carry at least 1/4 less net negative surface charge than fd phages. Morphology and thickness of phages are studied at different counterion concentrations (10(-3) , 10(-2) and 10(-1) M) by AFM, SEM and immunofluorescence analyses. Bundles induced by CoCl2 and CaCl2 are either metallized by chemical reduction or biomineralized for apatite-like material formation. EDX spectroscopy confirms the presence of Co, P and Ca peaks in mineralized samples. Such bottom-up manufactured phage scaffolds might be applied in bioengineering studies.

Angiogenic Type I Collagen Extracellular Matrix Integrated with Recombinant Bacteriophages Displaying Vascular Endothelial Growth Factors

“…Protocols for phage display were used for genetic modification to form fd‐p8SSGDD‐p3VEGF bacteriophage (fd‐VEGF phage; Figure a) . The flexible N ‐terminal 2‐amino‐acid (aa) overhang region (AE) of the major coat protein p8 of the wild‐type fd filamentous phage (wild‐type phage) was replaced with the amino acid sequence SS to promote electrostatic attractions between the phages and COL1 nanofibers under neutral pH.…”

“…E. coli K91BK and the fd‐tet vector were generously provided by Prof. George P. Smith (University of Missouri, MO, USA). The fd filamentous phage (wild‐type phage) was genetically engineered by first replacing the flexible, N ‐terminal 2‐aa region (AE) of the major coat protein p8 with the sequence SS, as previously reported . Then, the coding region of the 189‐aa isoform of VEGF‐A (human cDNA clone; ORIGENE) was fused to the N ‐terminal region of the minor coat protein p3 using the following primer pair: For_SfiI_VEGF, 5′‐ATTAGGCCCAGCCGGCCGCACCCATGGCAGAAGGAG‐3′ (forward) and 5′‐TAGTGCGGCCGCCCGCC‐3′ (reverse).…”

Trivalent Cation Induced Bundle Formation of Filamentous fd Phages

“…We have previously shown that the concentration of applied divalent ions should be at least 10 mM for obtaining phage bundles with Co 2+ and Ca 2+ . Increasing the counterion concentration further to 100 mM resulted in more intertwined and agglomerated phage bundles, showing the impact of applied charge ratios on bundling process of bacteriophages.…”

“…phage bundles with Co 2þ and Ca 2þ . [28] Increasing the counterion concentration further to 100 mM resulted in more intertwined and agglomerated phage bundles, showing the impact of applied charge ratios on bundling process of bacteriophages. Here, fd phages (10 10 cfu Á ml À1 ) were incubated in 1, 10, and 100 mM of AlCl 3 , YCl 3 , and LaCl 3 solutions for 1 h at room temperature.…”

Learning from nature – Novel synthetic biology approaches for biomaterial design

“…While mineralization has been perhaps the most popular materials-focused use of virus capsids [118], and the immunogenicity of virus particles represents an important application in biomedical science [119], a novel combination of these two features was recently described by Tang, Qin, and colleagues [120]. In order to improve the stability and shelf life of the icosahedral enterovirus type 71, a particle used for attenuated live virus vaccines, the virion was genetically modified to display a peptide motif known to nucleate the deposition of calcium phosphide (CaP) mineral.…”