B7-H3-Induced Signaling in Lung Adenocarcinoma Cell Lines with Divergent Epidermal Growth Factor Receptor Mutation Patterns

Abstract

The cosignal molecule B7-H3 is gaining attention due to its abnormal expression and abundant signal transduction in many types of malignancies. B7-H3-induced signaling includes at least three cascades: PI3K/AKT, JAK2/STAT3, and Raf/MEK/ERK1/2, which are also involved in epidermal growth factor receptor- (EGFR-) triggered signaling in lung adenocarcinoma cells. However, the correlation between B7-H3-induced signaling and EGFR signaling, and between B7-H3-targeted immunotherapy and EGFR-targeted therapy in lung adenocarcinoma, remains to be elucidated. Herein we find that knockout of B7-H3 gene decreased cell survival and increased EGFR-tyrosine kinase inhibitor gefitinib susceptibility of both H3255 and HCC827 cells, two lung adenocarcinoma cell lines harboring EGFR L858R (exon 21) and Del E746-A750 (exon 19) mutations, respectively. B7-H3 deletion resulted in dramatic reduction of phosphorylation level of AKT and STAT3 in H3255 cells while having mild-to-moderate suppression on AKT, STAT3, and ERK1/2 in HCC827 cells. Gefitinib had similar effects with B7-H3 deletion both in H3255 and HCC827 cells. Furthermore, B7-H3 ablation had significant synergistic effects with gefitinib in HCC827 cells. Collectively, our study reveals B7-H3-induced signaling in lung adenocarcinoma cell lines with divergent EGFR mutations, and a translational potential of combined targeted therapy of B7-H3 and EGFR in lung adenocarcinoma with EGFR Del E746-A750 mutation.

B7‑H3 promotes the epithelial‑mesenchymal transition of NSCLC by targeting SIRT1 through the PI3K/AKT pathway

“…The other possibility is that the signaling cascades downstream of B7-H3 operate differently according to the different cancer types and subtypes. It should be noted that our previous study demonstrated that B7-H3-induced signaling is dissimilar, comparing among lung adenocarcinoma cell lines with divergent epidermal growth factor receptor mutation patterns ( 23 ).…”

“…Knockout (KO) of the B7 - H3 gene in the A549 cell line was performed using CRISPR/Cas9 guide constructs, on the basis of a previously published protocol ( 23 ). The sequence of single guide RNA (sgRNA) was TTGATGTGCACAGCGTCCTGCGG, which was designed by using the online tool available from ZHANG LAB ( ).…”

Crosstalk between the B7/CD28 and EGFR pathways: Mechanisms and therapeutic opportunities

“…B7-H3 knockout increases susceptibility of NSCLC cell lines harboring activating EGFR mutations to EGFR inhibitor gefitinib. 25 Furthermore, B7-H3 ablation displayed significant synergistic effects with gefitinib in vitro . 25 Additionally, high B7-H3 expression is associated with EGFR WT status (multivariable OR = 2.80, 95% CI = 1.38–5.84; P = 0.0042), 99 hinting at the potential effectiveness of anti-B7-H3 therapy in EGFR WT lung adenocarcinoma.…”

“… 25 Furthermore, B7-H3 ablation displayed significant synergistic effects with gefitinib in vitro . 25 Additionally, high B7-H3 expression is associated with EGFR WT status (multivariable OR = 2.80, 95% CI = 1.38–5.84; P = 0.0042), 99 hinting at the potential effectiveness of anti-B7-H3 therapy in EGFR WT lung adenocarcinoma. In pancreatic cancer, activation of B7-H3 by an agonist induced the expression of EGFR, 24 suggesting that B7-H3 may be involved in regulating the EGFR signaling pathway in different cancer settings.…”

“…Increasing numbers of studies have demonstrated that the upregulation of B7/CD28 family members, such as PD-L1, B7x and HHLA2, is associated with activating EGFR mutations, 21 , 22 , 23 , 24 , 25 , 26 , 27 , 28 which may contribute to resistance to EGFR-targeted therapies by creating an immunosuppressive tumor microenvironment (TME). In this review, we will discuss the regulatory effect of EGFR signaling on the B7/CD28 pathways, which may inform future combination therapeutic strategies and overcome the current challenge of EGFR-TKI resistance.…”