Association of interleukin-4 genetic polymorphisms with sporadic Alzheimer's disease in Chinese Han population

Li, Wei; Qian, Xiaohua; Hong, Teng; Ding, Ying; Zhang, Li

doi:10.1016/j.neulet.2014.01.019

Cited by 17 publications

(13 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The -590 T allele had protective effects against AD in both studies, but the results varied for the -1098 T/G allele. In Caucasians, the -1098 T allele appears to be a risk factor [38], but the -1098 G allele may increase the susceptibility to AD in Han Chinese [39]. This discrepancy may be due to ethnic characteristics, but it should be noted that the study by Ribizzi et al was conducted with only 39 individuals (19 patients and 20 controls); therefore, further studies with larger samples are needed to confirm or deny this interaction.…”

Section: Il-4mentioning

confidence: 98%

“…Moreover, in vivo treatment with IL-4 reduces the accumulation of Ab and alleviates the cognitive impairments in AD animal models [109]. Two SNPs in the promoter region of IL-4 (-590 C/T and -1098 T/G) have been reported to influence AD risk in a study of Han Chinese and another study of Caucasians [38,39]. The -590 T allele had protective effects against AD in both studies, but the results varied for the -1098 T/G allele.…”

Section: Il-4mentioning

confidence: 99%

“…The significance of the SNPs might be related to the control of IL-4 gene transcription or IL-4 protein expression [110,111]; this would result in an imbalance between pro-and anti-inflammatory cytokines and ultimately accelerate the AD process. The ?33 T/C polymorphism of IL-4 has been identified and was assumed to affect AD risk, but negative results have been obtained in all three relevant studies conducted with Asians [39,112,113].…”

Section: Il-4mentioning

confidence: 99%

See 2 more Smart Citations

Inflammatory Cytokines and Alzheimer’s Disease: A Review from the Perspective of Genetic Polymorphisms

2016

View full text Add to dashboard Cite

Neuroinflammatory processes are a central feature of Alzheimer's disease (AD) in which microglia are over-activated, resulting in the increased production of proinflammatory cytokines. Moreover, deficiencies in the antiinflammatory system may also contribute to neuroinflammation. Recently, advanced methods for the analysis of genetic polymorphisms have further supported the relationship between neuroinflammatory factors and AD risk because a series of polymorphisms in inflammation-related genes have been shown to be associated with AD. In this review, we summarize the polymorphisms of both pro-and anti-inflammatory cytokines related to AD, primarily interleukin-1 (IL-1), IL-6, tumor necrosis factor alpha, IL-4, IL-10, and transforming growth factor beta, as well as their functional activity in AD pathology. Exploration of the relationship between inflammatory cytokine polymorphisms and AD risk may facilitate our understanding of AD pathogenesis and contribute to improved treatment strategies.

show abstract

Section: Il-4mentioning

confidence: 98%

Section: Il-4mentioning

confidence: 99%

Section: Il-4mentioning

confidence: 99%

See 1 more Smart Citation

Inflammatory Cytokines and Alzheimer’s Disease: A Review from the Perspective of Genetic Polymorphisms

2016

View full text Add to dashboard Cite

show abstract

“…Although the specific functional relevance of rs2243248 is not completely understood, a previous study identified it as a risk factor for sporadic Alzheimer's disease in the Chinese Han population [34]. Moreover, it has also been associated with a decreased risk of juvenile idiopathic arthritis [35].…”

Section: Discussionmentioning

confidence: 99%

Polymorphisms in IL-4/IL-13 pathway genes and glioma risk: an updated meta-analysis

Chen

et al. 2014

Tumor Biol.

View full text Add to dashboard Cite

Polymorphisms in interleukin (IL)-4/IL-13 pathway genes have previously been reported to be associated with glioma susceptibility, although results are inconsistent. We therefore performed an updated meta-analysis to determine a more precise estimation of this relationship. Twelve eligible studies were identified by searching PubMed, EMBASE, Web of Science, and the Cochrane Library electronic databases. Nine polymorphisms in genes within the IL-4/IL-13 pathway (IL-4 rs2243250, rs2070874, rs2243248, IL-4R rs1805011, rs1805012, rs1805015, rs1801275, and IL-13 rs20541 and rs1800925) were assessed for their relationship with glioma risk by computing odds ratios (ORs) and corresponding 95 % confidence intervals (CIs). Akaike's information criterion (AIC) was used to identify the best genetic model for each polymorphism. No association between IL-4/IL-13 pathway genetic polymorphisms and glioma risk was observed in the overall population, although a significant association was found between rs2234248 and glioblastoma when stratified by histological subtype (log-additive model, OR 1.57, 95 % CI 1.11-2.24). This meta-analysis therefore suggested that IL-4/IL-13 pathway genetic polymorphisms are not associated with glioma risk.

show abstract

“…The reaction volume was 20 μL, comprising 1 μL of genomic DNA, 0.2 mM of dNTPs, 0.5 U of TaKaRa Ex Taq HS DNA polymerase (TaKaRa Bio, Japan), and 0.5 μM of each of 2 primers. We used the primers 5'- ACTAGGCCTCACCTGATACG -3' (forward) and 5'- GTTGTAATGCAGTCCTCCTG -3' (reverse) [12] for analysis of IL-4 -590C/T, the primers 5'- GCCCCCACCAGTGGCTACC -3' (forward) and 5'- GAGGTCTTGGAAAGGCTTATAC -3' (reverse) [13] for analysis of IL-4Rα Q576R, the primers 5'- CTCTTCATGAGAGGCTGTCT -3' (forward) and 5'- TAACTCTTGGAGTTCACCTGG -3' (reverse) [14] for analysis of IFN-γR -611G/A. Identification of the alleles at each polymorphic site was performed by incubating the PCR product with the restriction enzyme BsmFI ( IL-4 ), MspI ( IL-4Rα ), and Hpy188I ( IFN-γR ) (New England Biolabs, Ipswich, MA, USA) followed by electrophoresis through a 2.0% agarose gel (for IL-4 ) or a 6% polyacrylamide gel (for IL-4Rα and IFN-γR ).…”

Section: Methodsmentioning

confidence: 99%

The cytokine polymorphisms affecting Th1/Th2 increase the susceptibility to, and severity of, chronic ITP

et al. 2017

View full text Add to dashboard Cite

BackgroundT-helper cell type 1 (Th1) polarization in chronic immune thrombocytopenia (cITP) has been reported at the protein and mRNA levels. We evaluated the impact of Th1/Th2 cytokine and cytokine receptor functional polymorphisms on both susceptibility to, and severity of, cITP. We analysed IFN-γ + 874 T/A, IFN-γR -611G/A, IL-4 -590C/T, and IL-4Rα Q576R polymorphisms in 126 cITP patients (male/female: 34/92; median age: 47.7 years) and 202 healthy control donors. Genotyping was determined by PCR and direct sequencing. The Th1/Th2 ratio was detected in peripheral blood mononuclear cells via flow cytometry.ResultscITP patients had a higher frequency of the IL-4Rα 576 non-QQ genotype compared to healthy subjects (P = 0.04). cITP patients with the IFN-γ +874 non-AA genotype (high expression type) showed more severe thrombocytopenia than those with the AA genotype (P < 0.05). cITP patients had a significantly higher Th1/Th2 ratio than control patients (P < 0.01); this ratio was inversely correlated with platelet counts. Furthermore, patients with both IFN-γ +874 non-AA genotype (high expression type) and IFN-γR −611 non-AA genotype (high-function type) had a significantly higher Th1/Th2 ratio (P < 0.05).ConclusionsThe cytokine polymorphisms affecting Th1/Th2 increase the susceptibility to, and severity of, chronic ITP.

show abstract

Association of interleukin-4 genetic polymorphisms with sporadic Alzheimer's disease in Chinese Han population

Cited by 17 publications

References 37 publications

Inflammatory Cytokines and Alzheimer’s Disease: A Review from the Perspective of Genetic Polymorphisms

Inflammatory Cytokines and Alzheimer’s Disease: A Review from the Perspective of Genetic Polymorphisms

Polymorphisms in IL-4/IL-13 pathway genes and glioma risk: an updated meta-analysis

The cytokine polymorphisms affecting Th1/Th2 increase the susceptibility to, and severity of, chronic ITP

Contact Info

Product

Resources

About