Association Analysis Between Variants in Bovine Progesterone Receptor Gene and Superovulation Traits in Chinese Holstein Cows

Abstract

The objective of this study was to identify a predictor to forecast superovulation response on the basis of associations between superovulation performance and gene polymorphism. The PCR-RFLP method was applied to detect two reported single nucleotide polymorphisms (SNPs) of G59752C and T81637C (rs41614030) located in introns 3 and 4 of the bovine progesterone receptor (PGR) gene in 171 Chinese Holstein cows treated for superovulation and evaluate its associations with superovulation traits. In polymorphic locus 81637, all cows without superovulation response were g.81637TC and g.81637TT genotypes. Association analysis showed that these two SNPs had significant effects on the total number of ova (TNO) (p<0.05), and the T81637C polymorphism was significantly associated with the number of transferable embryos (p<0.05). In addition, significant additive effects (p<0.05) on TNO were detected in the polymorphisms of G59752C and T81637C. These results showed for the first time that the G59752C and T81637C polymorphisms in PGR gene were associated with superovulation traits and indicated that PGR gene can be used as a predictor for superovulation in Chinese Holstein cows.

Fertil ve Subfertil Siyah Alaca Düveler Arasında CYP19, ERα, PGR Allel Frekanslarının Dağılımı

“…When the results of the present study were compared with those of others, the allele and genotype frequencies were similar (Table 2) to the frequencies observed in the previous studies performed in European cattle breeds [15,21,22,28,35,36] . There has been only one study of ERα [20] in which the A allele was predominant, in contrast with all the other studies.…”

“…However, there have been only limited efforts to determine the major genes influencing reproductive traits [12] . While in previous studies, polymorphisms in the CYP19 [16,[18][19][20][21]33] , ERα [20,21,25,29,34] , and PGR [15,28,35] genes were evaluated in cows, the present study is the first on these gene polymorphisms in subfertile heifers.…”

“…This contradiction might derive from the differences in nomenclature used in this study. There have been more studies performed on the relationships between CYP19 and ERα polymorphisms [20][21][22][23]28] and some reproductive and productive traits, when considering them with PGR [28] . However, the results obtained from these studies were not in concordance with each other.…”

“…Yang et al [28] ERα TTTGGTTAACGAGGTGGAG TGTGACACAGGTGGTTTTTC BglI Szreder and Zwierzchowski [29] CYP19 CTCTCGATGAGACAGGCTCC ACAATGCTGGGTTCTGGACT PvuII Vanselow et al [31] Distributions of CYP19, ERα and ... allele and genotype frequency distributions between the two groups of heifers are given in Table 2.…”

“…Progesterone plays a key role in the establishment and maintenance of pregnancy [15,28] . Because progesterone activity is regulated by progesterone receptor, the progesterone receptor gene (PGR) has been considered a good candidate for reproduction [27] .…”