Aryl Hydrocarbon Receptor-Mediated Transcription: Ligand-Dependent Recruitment of Estrogen Receptor α to 2,3,7,8-Tetrachlorodibenzo- p-Dioxin-Responsive Promoters

Abstract

Using chromatin immunoprecipitation assays, we studied the 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-mediated recruitment of the aryl hydrocarbon receptor (AhR) and several coregulators to the CYP1A1 promoter. AhR displayed a time-dependent recruitment, reaching a peak at 75 min and maintaining promoter occupancy for the remainder of the time course. Recruitment of AhR was followed by TIF2/SRC2, which preceded CBP, histone H3 acetylation, and RNA polymerase II (RNAPII). Simultaneous recruitment to the enhancer and the TATA box region suggests the formation of a large multiprotein complex bridging the two promoter regions. Interestingly, estrogen receptor ␣ (ER␣) displayed a TCDD-and time-dependent recruitment to the CYP1A1 promoter, which was increased by cotreatment with estradiol. Transfection in HuH7 human liver cells confirmed previously reported ER␣ enhancement of AhR activity. In contrast, TCDD did not induce the recruitment of ER␣ to the estrogen-responsive pS2 promoter, and after 120 min of cotreatment with estradiol, ER␣ is still present on the CYP1A1 promoter but no longer at pS2. RNA interference studies with T47D cells support a role for ER␣ in TCDD-dependent CYP1A1 expression. Our data suggest that ER␣ acts as a coregulator of AhR-mediated transcriptional activation and that the recruitment of ER␣ by AhR represents a novel mechanism AhR-ER␣ cross talk.

Variable pathological and clinical features of a large Brazilian family harboring a mutation in the aryl hydrocarbon receptor-interacting protein gene

“…AhR-mediated gene transcription is modulated via direct recruitment of estrogen receptor-a, which links estradiol activity to AhRdioxin-mediated signaling (30,31). This and other associated pathways (e.g.…”

Aryl Hydrocarbon Receptor-Dependent Induction of Flavin-Containing Monooxygenase mRNAs in Mouse Liver

“…ChIP assays were performed according to Matthews et al (2005) except that 100 to 120 mg of snap-frozen liver was homogenized and cross-linked in 1% formaldehyde, and the DNA was isolated using a PCR purification kit (BioBasic, Inc., East Markham, ON, Canada) and eluted in 50 l. ChIP DNA (1 l) was amplified by PCR with primers 5ЈAAGCCAAGC-CAGAAAATCAA3Ј and 5ЈTCGAGGAACAGAGTGCAATG3Ј for the mouse Fmo3 AHRE (Ϫ3183 to Ϫ3260 relative to the transcriptional start site). For real-time PCR, Power SYBR Green PCR Master Mix was used to amplify the DNA fragments.…”

Dioxin Induces an Estrogen-Like, Estrogen Receptor-Dependent Gene Expression Response in the Murine Uterus

“…Moreover, TCDD increases the DNA-binding activity of the ER independent of estrogen in the rat uterus (Chaffin et al, 1996), and treatment of MCF-7 cells with TCDD results in G 0 /G 1 to S-phase transition and estrogen like mitogenic effects (Abdelrahim et al, 2003). Studies have also shown that ER and AhR interact (Brunnberg et al, 2003;Beischlag and Perdew, 2005), and there is a discrepancy as to the coactivator or corepressor function of ER on AhR/ARNTmediated induction of Cyp1a1 (Beischlag and Perdew, 2005;Matthews et al, 2005). Reports also indicate that the ligandactivated AhR/ARNT associates with the unliganded ER to form a functional complex that binds EREs (Ohtake et al, 2003).…”