ArfGAP3 Is a Component of the Photoreceptor Synaptic Ribbon Complex and Forms an NAD(H)-Regulated, Redox-Sensitive Complex with RIBEYE That Is Important for Endocytosis

Dembla, Mayur; Wahl, Silke; Katiyar, Rashmi; Schmitz, Frank

doi:10.1523/jneurosci.3837-13.2014

Cited by 24 publications

(45 citation statements)

References 65 publications

(70 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…pCASPR1‐mCherryN1. CASPR1 full‐length cDNA was cloned into pmCherryN1 vector (Dembla et al , ). For this purpose, full‐length CASPR1 cDNA was amplified via PCR using forward primer AAAAGAATTCTGGCCACCATGATGAGT CTCCGGC, reverse primer AAAAACCGGTGGTTCAGACCTGGACTCCTCC and CASPR1 cDNA (BC156962.1; IMAGE clone:#100063633) as template.…”

Section: Methodsmentioning

confidence: 99%

Early auto‐immune targeting of photoreceptor ribbon synapses in mouse models of multiple sclerosis

et al. 2018

View full text Add to dashboard Cite

Optic neuritis is one of the first manifestations of multiple sclerosis. Its pathogenesis is incompletely understood, but considered to be initiated by an auto‐immune response directed against myelin sheaths of the optic nerve. Here, we demonstrate in two frequently used and well‐validated mouse models of optic neuritis that ribbon synapses in the myelin‐free retina are targeted by an auto‐reactive immune system even before alterations in the optic nerve have developed. The auto‐immune response is directed against two adhesion proteins (CASPR1/CNTN1) that are present both in the paranodal region of myelinated nerves as well as at retinal ribbon synapses. This occurs in parallel with altered synaptic vesicle cycling in retinal ribbon synapses and altered visual behavior before the onset of optic nerve demyelination. These findings indicate that early synaptic dysfunctions in the retina contribute to the pathology of optic neuritis in multiple sclerosis.

show abstract

Section: Methodsmentioning

confidence: 99%

Early auto‐immune targeting of photoreceptor ribbon synapses in mouse models of multiple sclerosis

et al. 2018

View full text Add to dashboard Cite

show abstract

“…Recent reviews are also available on the redox processing in the secretory pathway [33, 34, 120] and in mitochondrial import [35, 36]. Relatively less information is available on vectorial redox processing during endocytosis and proteolysis in lysosomes, but evidence is available suggesting that analogous systems are present [121, 122]. …”

Section: Protein Cys Redox Regulationmentioning

confidence: 99%

The cysteine proteome

Chandler

Jones

2015

Free Radical Biology and Medicine

307

243

View full text Add to dashboard Cite

The cysteine (Cys) proteome is a major component of the adaptive interface between the genome and the exposome. The thiol moiety of Cys undergoes a range of biologic modifications enabling biological switching of structure and reactivity. These biological modifications include sulfenylation and disulfide formation, formation of higher oxidation states, S-nitrosylation, persulfidation, metallation, and other modifications. Extensive knowledge about these systems and their compartmentalization now provides a foundation to develop advanced integrative models of Cys proteome regulation. In particular, detailed understanding of redox signaling pathways and sensing networks is becoming available to discriminate network structures. This research focuses attention on the need for atlases of Cys modifications to develop systems biology models. Such atlases will be especially useful for integrative studies linking the Cys proteome to imaging and other omics platforms, providing a basis for improved redox-based therapeutics. Thus, a framework is emerging to place the Cys proteome as a complement to the quantitative proteome in the omics continuum connecting the genome to the exposome.

show abstract

“…In the retina, the lipid product of LPAAT, phosphatidic acid, is enriched at ribbon synapses and may influence the trafficking of synaptic vesicles (Schwarz et al, 2011). Vesicle trafficking may also be modulated by the NAD(H) binding site of RIBEYE as protein-protein interactions of RIBEYE with regulators of vesicle formation, ArfGAP3 and Arf1, are dependent on NAD(H) (Dembla et al, 2014). …”

Section: Molecular and Developmental Aspects Of Ribbon Synapsesmentioning

confidence: 99%

Ribbon synapses in zebrafish hair cells

Nicolson

2015

Hearing Research

View full text Add to dashboard Cite

The basic architecture and functionality of ribbon synapses of mechanosensitive hair cells are well conserved among vertebrates. Forward and reverse genetic methods in zebrafish (Danio rerio) have identified components that are critical for the development and function of ribbon synapses. This review will focus on the findings of these genetic approaches, and discuss some emergent concepts on the role of the ribbon body and calcium in synapse development, and how perturbations in synaptic vesicles lead to a loss of temporal fidelity at ribbon synapses.

show abstract

ArfGAP3 Is a Component of the Photoreceptor Synaptic Ribbon Complex and Forms an NAD(H)-Regulated, Redox-Sensitive Complex with RIBEYE That Is Important for Endocytosis

Cited by 24 publications

References 65 publications

Early auto‐immune targeting of photoreceptor ribbon synapses in mouse models of multiple sclerosis

Early auto‐immune targeting of photoreceptor ribbon synapses in mouse models of multiple sclerosis

The cysteine proteome

Ribbon synapses in zebrafish hair cells

Contact Info

Product

Resources

About