Arabidopsis alternative oxidase sustains Escherichia coli respiration.

Abstract

Glutamyl-tRNA reductase, encoded by the hemA gene, is the first enzyme in porphyrin biosynthesis in many organisms. Hemes, important porphyrin derivatives, are essential components of redox enzymes, such as cytochromes. Thus a hemA Escherichia coli strain (SASX41B) is deficient in cytochrome-mediated aerobic respiration. Upon complementation of this strain with an Arabidopsis thaliana cDNA library, we isolated a clone which permitted the SASX41B strain to grow aerobically. The clone encodes the gene for Arabidopsis alternative oxidase, whose deduced amino acid sequence was found to have 71% identity with that of the enzyme from the voodoo lily, Sauromatum guttatum. The Arabidopsis protein is expressed as a 31-kDa protein in E. coli and confers on this organism cyanide-resistant growth, which in turn is sensitive to salicylhydroxamate. This implies that a single polypeptide is sufficient for alternative oxidase activity. Based on these observations we propose that a cyanide-insensitive respiratory pathway operates in the transformed E. coli hemA strain. Introduction of this pathway now opens the way to genetic/molecular biological investigations of alternative oxidase and its cofactor.

Targeting the Plant Alternative Oxidase Protein to Mitochondria Confers Cyanide-insensitive Respiration

“…Although the alternative oxidase has previously been expressed in E. coli (19), detailed analysis of its properties in this system have yet to emerge. Unlike H. anomala (37), a cyanide-resistant alternative oxi- dase cannot be induced in S. pombe by growing the cells on antimycin, and previous characterization of these mitochondria indicates that S. pombe mitochondria possess only cytochrome c oxidase as a terminal oxidase (27).…”

“…Plant tissues have proved to be a difficult source from which to purify the enzyme, and its counterpart in H. anomala has yet to be demonstrated as being kinetically equivalent to that of the plant enzyme (1,3). A cDNA from Arabidopsis thaliana (19) has been successfully used to complement an Escherichia coli mutation that appears unable to grow aerobically, suggesting that the expression of a single protein species is sufficient to obtain a functional enzyme. To date, however, the alternative oxidase has not been expressed in eukaryotic cells such as yeast and, in particular, has not been targeted to mitochondria of non-plant origin.…”

EPR Studies of the Mitochondrial Alternative Oxidase

“…Mutagenesis and Expression-The A. thaliana alternative oxidase gene AOX1a was amplified with polymerase chain reaction (PCR) using pAOX (22) as a template, and the primers (cggaattcagcatgcatatggctagcacgatt) and (caggatccgtcgactcaatgatacccaat), and cloned into the EcoRI-BamHI sites of pMALc2 (New England BioLabs) such that the coding region of AOX (omitting the signal sequence) was fused to the C terminus of MBP. The AOX gene in this construct, pAtAOc2, was sequenced to ensure that no mutations were introduced and subsequently transferred to pMALc2X (New England BioLabs) with an EcoRI-BamHI digest to form pAtAOc3.…”

Characterization of two genes encoding the mitochondrial alternative oxidase in Chlamydomonas reinhardtii

“…The signal probably corresponded to the mature AOX2 mRNA, since the size of AOX2 cDNA can be estimated to be approximately 1.8-1.9 kb. Kirimura et al 1999), Candida albicans (Ca;Huh and Kang 1999), Magnaporthe grisea (Mg; Yukioka et al 1998), Neurospora crassa (Nc;Li et al 1996) and Pichia anomala (Pa; formerly known as Hansenula anomala; Sakajo et al 1991) and the higher plants Arabidopsis thaliana (At; Kumar and Soil 1992) and Sauromatum guttatum (Sg; Rhoads and McIntosh 1991). Amino acid residues identical in at least 50% of sequences are shown on a black background.…”