Application of the denaturing gradient gel electrophoresis (DGGE) technique as an efficient diagnostic tool for ciliate communities in soil

Jousset, Alexandre; Lara, Enrique; Nikolausz, Marcell; Harms, Hauke; Chatzinotas, Antonis

doi:10.1016/j.scitotenv.2009.09.056

Cited by 42 publications

(13 citation statements)

References 39 publications

(43 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…PCR amplification and DGGE of whole coral samples. From crushed and extracted samples, ciliate 18S rRNA genes were amplified with an un‐nested PCR approach (Jousset et al ., 2010). Three 10 µl replicates of each sample were run using 8 ng of DNA product (PCR mixture as above) with the forward primer CilF (5′‐TGGTAGTGTATTGGACWACCA‐3′) with a 36 bp GC clamp (Muyzer and Smalla, 1998) attached to the 5′ end and CilDGGE‐r (5′‐TGAAAACATCCTTGGCAACTG‐3′).…”

mentioning

confidence: 99%

Ciliate and bacterial communities associated with White Syndrome and Brown Band Disease in reef‐building corals

Sweet

Bythell

2012

Environmental Microbiology

View full text Add to dashboard Cite

White Syndrome (WS) and Brown Band Disease (BrB) are important causes of reef coral mortality for which causal agents have not been definitively identified. Here we use culture-independent molecular techniques (DGGE and clone libraries) to characterize ciliate and bacterial communities in these diseases. Bacterial (16S rRNA gene) and ciliate (18S rRNA gene) communities were highly similar between the two diseases. Four bacterial and nine ciliate ribotypes were observed in both diseases, but absent in non-diseased specimens. Only one of the bacteria, Arcobacter sp. (JF831360) increased substantially in relative 16S rRNA gene abundance and was consistently represented in all diseased samples. Four of the eleven ciliate morphotypes detected contained coral algal symbionts, indicative of the ingestion of coral tissues. In both WS and BrB, there were two ciliate morphotypes consistently represented in all disease lesion samples. Morph1 (JN626268) was observed to burrow into and underneath the coral tissues at the lesion boundary. Morph2 (JN626269), previously identified in BrB, appears to play a secondary, less invasive role in pathogenesis, but has a higher population density in BrB, giving rise to the visible brown band. The strong similarity in bacterial and ciliate community composition of these diseases suggests that they are actually the same syndrome.

show abstract

mentioning

confidence: 99%

Ciliate and bacterial communities associated with White Syndrome and Brown Band Disease in reef‐building corals

Sweet

Bythell

2012

Environmental Microbiology

View full text Add to dashboard Cite

show abstract

“…T-RFs that were enriched in heavy fractions of 13 C treatments but not in 12 C treatments were regarded as 13 C labeled, even if those T-RFs occurred in the light fractions of 13 C treatments. The eukaryotic primer set, as well as primers targeting two ubiquitously distributed bacterivorous flagellate groups, i.e., Chrysophyceae and Kinetoplastidae, and the ciliates (24,25) were applied. T-RFLP analysis was conducted as described in a previous study (26) using the restriction enzymes MspI, RsaI, MseI, and Cfr and RsaI for 18S rRNA amplicons of total eukaryotes, ciliates, Kinetoplastidae, and Chrysophyceae, respectively.…”

Section: Identification Of 13 C-labeled 18s Rrna Phylotypes By T-rflpmentioning

confidence: 99%

Assimilation of Cellulose-Derived Carbon by Microeukaryotes in Oxic and Anoxic Slurries of an Aerated Soil

Chatzinotas

Schellenberger

Glaser

et al. 2013

Appl Environ Microbiol

Self Cite

View full text Add to dashboard Cite

Soil microeukaryotes may trophically benefit from plant biopolymers. However, carbon transfer from cellulose into soil microeukaryotes has not been demonstrated so far. Microeukaryotes assimilating cellulose-derived carbon in oxic and anoxic soil slurries were therefore examined by rRNA-based stable-isotope probing. Bacteriovorous flagellates and ciliates and, likely, mixotrophic algae and saprotrophic fungi incorporated carbon from supplemental [U-(13)C]cellulose under oxic conditions. A previous study using the same soil suggested that cellulolytic Bacteria assimilated (13)C of supplemental cellulose. Thus, it can be assumed that ciliates, cercozoa, and chrysophytes assimilated carbon by grazing upon and utilizing metabolic products of Bacteria that hydrolyzed cellulose in the soil slurries.

show abstract

“…We analyzed the ciliate community using DGGE modified after Jousset et al (2010). A fragment of the 18S rRNA gene was amplified from extracted DNA by seminested PCR.…”

Section: Dgge Analysis Of Ciliate Communitymentioning

confidence: 99%

“…Ciliates are a monophyletic group of protists, which allows us to use a molecular approach based on the SSU rRNA gene to analyze the community structure of soil ciliates (Lara et al 2007;Jousset et al 2010;Shimano et al 2012). One of the greatest advantages of studying ciliates is that some high-level clades (i.e., orders and classes) are characterized by common metabolic and life-history features (Lara and Acosta-Mercado 2012), which rationalizes the use of molecular-based information of the ciliate communities as soil bioindicators.…”

Section: Introductionmentioning

confidence: 99%

Impact of soil solarization on the ciliate community structure of a greenhouse soil

Murase

Shinohara

Yokoe

et al. 2015

Soil Science and Plant Nutrition

View full text Add to dashboard Cite

Soil solarization is an ecologically friendly method of controlling various plant pathogens and pests, but also affects non-pathogenic members of the soil biota. Here, we studied the impact of soil solarization on the community structure of soil ciliates using a culture-independent molecular approach, namely denaturing gradient gel electrophoresis (DGGE) of targeted 18S rRNA gene fragments. Greenhouse soil with added organic fertilizers was solarized for 33 days at an average temperature of 47-48°C. Solarization caused a drastic change in the ciliate community. The variation between replicates was large, which suggested that the distribution of ciliates was spatially heterogeneous in the soil, probably due to their decreased numbers. In contrast, non-solarized soil had a stable and homogeneous ciliate community during the experimental period. In solarized soil, most of the original ciliate community recovered 76 days after solarization. Sequence analysis of DGGE fragments indicated that both r-selected and K-selected species of ciliates were affected by solarization but recovered with time after solarization. Our results demonstrated both the vulnerability and resilience of the ciliate community to soil solarization and also the utility of using molecular-based analysis of ciliate communities as bioindicators of soil stress caused by solarization.

show abstract

Application of the denaturing gradient gel electrophoresis (DGGE) technique as an efficient diagnostic tool for ciliate communities in soil

Cited by 42 publications

References 39 publications

Ciliate and bacterial communities associated with White Syndrome and Brown Band Disease in reef‐building corals

Ciliate and bacterial communities associated with White Syndrome and Brown Band Disease in reef‐building corals

Assimilation of Cellulose-Derived Carbon by Microeukaryotes in Oxic and Anoxic Slurries of an Aerated Soil

Impact of soil solarization on the ciliate community structure of a greenhouse soil

Contact Info

Product

Resources

About