Application of fusion PCR to the amplification of full-length ORF sequences of different splicing variants of from HeLa cells

Wu, Jin; Lu, Guanting; Wu, Jianwei; Yang, Hua; Yu, Zhicao; Mu, Shijie; Zhang, Hong-Mei

doi:10.1093/abbs/gmx093

Cited by 1 publication

(1 citation statement)

References 8 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The resultant plasmids were then transformed into Stbl3 competent cells. Bacteria liquid PCR (primers listed in Table 1) and sanger sequencing assays were applied to screen and validate positive clones as previous reported [13]. 7…”

Section: Oligo Design and Vector Constructionmentioning

confidence: 99%

Construction and application of CRISPR-mediated TBCK-Knockout system in multiple human and mouse cell models

WU,

ZHU,

DYNKA

et al. 2023

Preprint

View full text Add to dashboard Cite

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

show abstract

Section: Oligo Design and Vector Constructionmentioning

confidence: 99%