APOE ε4-dependent effects on the early amyloid pathology in induced neurons of patients with Alzheimer’s disease

Abstract

Background The ε4 allele of apolipoprotein E (APOE ε4) is the strongest known genetic risk factor for late-onset Alzheimer’s disease (AD), associated with amyloid pathogenesis. However, it is not clear how APOE ε4 accelerates amyloid-beta (Aβ) deposition during the seeding stage of amyloid development in AD patient neurons. Methods AD patient induced neurons (iNs) with an APOE ε4 inducible system were prepared from skin fibroblasts of AD patients. Transcriptome analysis was performed using RNA isolated from the AD patient iNs expressing APOE ε4 at amyloid-seeding and amyloid-aggregation stages. Knockdown of IGFBP3 was applied in the iNs to investigate the role of IGFBP3 in the APOE ε4-mediated amyloidosis. Results We optimized amyloid seeding stage in the iNs of AD patients that transiently expressed APOE ε4. Remarkably, we demonstrated that Aβ pathology was aggravated by the induction of APOE ε4 gene expression at the amyloid early-seeding stage in the iNs of AD patients. Moreover, transcriptome analysis in the early-seeding stage revealed that IGFBP3 was functionally important in the molecular pathology of APOE ε4-associated AD. Conclusions Our findings suggest that the presence of APOE ε4 at the early Aβ-seeding stage in patient iNs is critical for aggravation of sporadic AD pathology. These results provide insights into the importance of APOE ε4 expression for the progression and pathogenesis of sporadic AD.

Microglia Depletion Reduces Human Neuronal APOE4-Driven Pathologies in a Chimeric Alzheimer’s Disease Model

“…First, we demonstrated that the APOE4 isoform increased the number of Aβ, Thioflavin-S, and p-tau aggregates in hE4-E4KI mice compared to hE3-E3KI mice. These results match a litany of previous studies, including our previous chimeric AD model study, that show APOE4’s exacerbation of amyloid and/or tau pathology 12,19,21,25,37,45 . We also explored the less well-established effect of microglia depletion on human neuronal APOE4-driven AD pathologies.…”

“…When we quantified the number of Aβ aggregates per square micrometer within 100 μm of the transplants, we found that APOE isoform had a significant effect on Aβ aggregate counts. Of the chimeric mice fed with control chow, the hE3-E3KI mice displayed significantly fewer Aβ aggregates than hE4-E4KI mice (Figure 3B), confirming previous findings that APOE4 exacerbates amyloid pathology 12,19,25,45 . Upon microglial depletion, the average number of Aβ aggregates in the hE4-E4KI condition was reduced by half, with a p-value just shy of significance (Figure 3B, red text).…”

Direct Conversion of Fibroblast into Neurons for Alzheimer’s Disease Research: A Systematic Review

“…All studies used human fibroblasts from skin biopsies, either post- or ante-mortem, as the starting material for conversion to iNs (see Table 2 ). Two research teams were represented with several papers (one team with three papers: Traxler et al [ 62 ], Mertens et al [ 64 ], and Herdy et al [ 63 ]; and another team with two papers: Kim et al [ 60 ] and Kim et al [ 61 ]). In their respective papers, these teams used overlapping methods and overlapping source material for iNs.…”

Efficient generation of brain organoids using magnetized gold nanoparticles

“…KAT2B shRNA (Target sequence: GCAGATACCAAACAAGTTTAT) was purchased from Applied Biological Materials Inc. Lentivirus production was prepared as described previously 41 . Briefly, the lentivirus was produced in HEK293T cells grown in Dulbecco’s Modified Eagle Medium containing 10% fetal bovine serum and 1% penicillin/streptomycin.…”