Antiviral activity of a polysaccharide from Laminaria japonica against enterovirus 71

Yue, Yingying; Li, Zhihui; P, Li; Song, Nannan; Li, Bingqing; Lin, Wei; Liu, Shuntao

doi:10.1016/j.biopha.2017.09.117

Cited by 32 publications

(24 citation statements)

References 47 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…35,36 To our knowledge, plant-origin polysaccharides have a considerable number of biological activities, such as antiinflammatory, 22 anticancer, 21 and antiviral activities, 37,38 and the virucidal activity of polysaccharides has been the focus of many research studies. As previously reported, the polysaccharide from L. japonica has anti-EV71 and anti-RSV 24,39 activities, but the detailed mechanisms are unclear. Considering the close relationship between severe HFMD and central nervous system infection, we used a microglia cell line, HM1900, in this study to investigate whether LJ04 can inhibit EV71 in neurons.…”

Section: Discussionmentioning

confidence: 88%

“…The acidic polysaccharide LJ04 was extracted as previously described . In brief, crushed L. japonica was added to a volume of deionized water equal to 50 times the volume of L. japonica , and the mixture was heated to 100°C.…”

Section: Methodsmentioning

confidence: 99%

“…In brief, the cell culture medium was replaced with PBS, and the cells were incubated at 37°C until a circular morphology was obtained and the cells had detached from the plate. The cells (5 × 10 5 ) and EV71 (5 × 10 6 TCID 50 ) were then co‐incubated with or without LJ04 (10 or 1 µg/ml, diluted with RPMI‐1640 containing 2% FBS) for 3 hr at 4°C, and one of the following was performed: (i) the cells were washed three times with PBS, subjected to three freeze–thaw cycles, centrifuged at 10,000 g and 4°C for 10 min, and their supernatant was collected and used for determination of the TCID 50 values; or (ii) the cells were washed three times with PBS, total RNA was extracted using the TRIzol reagent (Qiagen, Hilden, Germany) according to the manufacturer's recommended protocol, and reverse transcription was performed as previously described with EV71‐specific primers (forward primer: 5′‐GCAGCCCAAAAGAACTTCAC‐3′, reverse primer: 5′‐ATTTCAGCAGCTTGGAGTGC‐3′). The E31 plasmids containing the whole genome of EV71 were serially diluted tenfold and used as a reference standard to generate the standard curve and quantify the number of viral RNA copies.…”

Section: Methodsmentioning

confidence: 99%

“…The acidic polysaccharide LJ04 was extracted as previously described. 24 In brief, crushed L. japonica was added to a volume of deionized water equal to 50 times the volume of L. japonica, and the mixture was heated to 100°C. After centrifugation, trichloroacetic acid was added to the supernatant to a final concentration of 10% (wt/vol), and the mixture was stirred for 2 hr to remove proteins and glycoproteins.…”

Section: Extraction and Analysis Of Acidic Polysaccharidesmentioning

confidence: 99%

See 3 more Smart Citations

Virucidal activity and the antiviral mechanism of acidic polysaccharides against Enterovirus 71 infection in vitro

Cui

Liu

et al. 2020

Microbiology and Immunology

Self Cite

View full text Add to dashboard Cite

Enterovirus 71 (EV71) is the predominant pathogen for severe hand, foot, and mouth disease (HFMD) in children younger than 5 years, and currently no effective drugs are available for EV71. Thus, there is an urgent need to develop new drugs for the control of EV71 infection. In this study, LJ04 was extracted from Laminaria japonica using diethylaminoethyl cellulose‐52 with 0.4 mol/l NaCl as the eluent, and its virucidal activity was evaluated based on its cytopathic effects on a microplate. LJ04 is composed of fucose, galactose, and mannose and mainly showed good virucidal activity against EV71. The antiviral mechanisms of LJ04 were the direct inactivation of the virus, the blockage of virus binding, disruptions to viral entry, and weak inhibitory activity against the nonstructural protein 3C. The two most important findings from this study were that LJ04 inhibited EV71 proliferation in HM1900 cells, which are a human microglia cell line, and that LJ04 can directly inactivate EV71 within 2 hr at 37°C. This study demonstrates for the first time the ability of a polysaccharide from L. japonica to inhibit viral and 3C activity; importantly, the inhibition of 3C might have a minor effect on the antiviral effect of LJ04. Consequently, our results identify LJ04 as a potential drug candidate for the control of severe EV71 infection in clinical settings.

show abstract

Section: Discussionmentioning

confidence: 88%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Extraction and Analysis Of Acidic Polysaccharidesmentioning

confidence: 99%

See 2 more Smart Citations

Virucidal activity and the antiviral mechanism of acidic polysaccharides against Enterovirus 71 infection in vitro

Cui

Liu

et al. 2020

Microbiology and Immunology

Self Cite

View full text Add to dashboard Cite

show abstract

“…Figure 1 shows repeated structural units of LJP. Studies have found that Laminaria japonica polysaccharides have a variety of biological activities, including promoting fertility [4], alleviating metabolic syndrome [5], preventing vascular calcification [6], resisting virus [7,8], immunoregulating [9], and antioxidating [10]. In addition, Laminaria japonica polysaccharides have inhibitory effect on a variety of tumor cells, such as liver cancer cells, nasopharyngeal carcinoma cells, cervical cancer cells, and leukemia cells [11][12][13][14], but there are no reports on the effect of Laminaria japonica polysaccharides on human non-small-cell lung cancer A549 cells.…”

Section: Introductionmentioning

confidence: 99%

Effects of Laminaria Japonica Polysaccharides on the Survival of Non-Small-Cell Lung Cancer A549 Cells

Yao

Qian

Qin

2019

International Journal of Polymer Science

View full text Add to dashboard Cite

Objective. To investigate the effect of Laminaria japonica polysaccharides (LJP) on the survival of non-small-cell lung cancer (NSCLC) A549 cells and its mechanism. Methods. In vitro: the cells were randomly divided into control group, LJP (5 mg/ml) group, LJP (10 mg/ml) group, and LJP (20 mg/ml) group. After corresponding treatment, the survival rate and the expression of proteins related to proliferation, apoptosis, epithelial-mesenchymal transition (EMT), and signaling pathway were detected by CCK8 assay and Western blot, respectively. In vivo: a xenograft model was established to detect the tumor volume and mass and the expression of the above pathway proteins. Results. Compared with the control group, LJP decreased the survival rate of A549 cells (P<0.05), inhibited the protein expression of Ki67 and PCNA (P<0.05), downregulated the expression of Bcl-2 while upregulated the expression of Bax, cl-caspase-3, and cl-caspase-9 (P<0.05), upregulated the expression of E-cadherin, downregulated the expression of vascular endothelial growth factor (VEGF) and N-cadherin (P<0.05), and downregulated β-catenin, transcription factor-4 (TCF4), and c-Myc protein expression levels (P<0.05). In vivo: LJP decreased the volume and mass of the xenograft tumors and downregulated β-catenin, TCF4, and c-Myc protein expression levels compared with the control group (P<0.05). Conclusion. LJP can inhibit the survival of non-small-cell lung cancer A549 cells in vitro, and its mechanism is related to the inhibition of activation of β-catenin/TCF4 pathway activation.

show abstract

Schisandra chinensis (Turcz.) Baill. polysaccharide inhibits influenza A virus in vitro and in vivo

Guo

et al. 2023

FEBS Open Bio

View full text Add to dashboard Cite

Influenza virus is prone to seasonal spread and widespread outbreaks, which pose important challenges to public health security. Therefore, it is important to effectively prevent and treat influenza virus infection. Schisandra polysaccharide (SPJ) is a polysaccharide derived from the fruit of Schisandra chinensis (Turcz.) Baill. In this study, we evaluated the antiviral activity of SPJ in vitro and in vivo, especially against influenza A virus (IAV) infection. By analyzing SPJ structure and monosaccharide composition, the molecular weight of SPJ was determined to be 115.5 KD, and it is composed of galacturonic acid (89.4%), rhamnose (0.8%), galactose (4.4%), arabinose (3.8%) and glucose (1.7%). Immunofluorescence analysis showed that SPJ treatment reduced the positive rate of viral nucleoproteins in cells, indicating that the compound had an inhibitory effect on influenza virus replication. Furthermore, SPJ therapy improved the survival of infected mice. Lung virus titer assays indicated that SPJ treatment significantly reduced viral‐loading in the lung tissue of infected mice, and alleviated the pathological damage caused by influenza virus infection. Moreover, SPJ reduced cytokine expression during influenza virus challenge. In conclusion, SPJ has anti‐influenza virus effects, and may have potential as an anti‐influenza drug candidate in further clinical studies.

show abstract

Antiviral activity of a polysaccharide from Laminaria japonica against enterovirus 71

Cited by 32 publications

References 47 publications

Virucidal activity and the antiviral mechanism of acidic polysaccharides against Enterovirus 71 infection in vitro

Virucidal activity and the antiviral mechanism of acidic polysaccharides against Enterovirus 71 infection in vitro

Effects of Laminaria Japonica Polysaccharides on the Survival of Non-Small-Cell Lung Cancer A549 Cells

Schisandra chinensis (Turcz.) Baill. polysaccharide inhibits influenza A virus in vitro and in vivo

Contact Info

Product

Resources

About