Antibacterial and Anti-inflammatory Potential of Morus alba Stem Extract

Yiemwattana, Ichaya; Chaisomboon, Niratcha; Jamdee, Kusuma

doi:10.2174/1874210601812010265

Cited by 16 publications

(10 citation statements)

References 23 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Then, the dried plant was extracted by maceration technique using 80% ethanol for two cycles at room temperature as previously described. 12 MSE was dissolved in 0.05% dimethyl sulfoxide and diluted with the culture medium to obtain the designed concentrations.…”

Section: Methodsmentioning

confidence: 99%

“…Two-step quantitative real-time PCR was performed in duplicate using the LightCycler 480 II real-time PCR System (Roche Diagnostics) as previously described. 12 The sequences of the PCR primers were used as follow: MMP-1, forward, TGGACCTGGAGGAAATCTTGC, and reverse, AGAGTCCAAGAGAAT GGCCGA; MMP-9, forward, GAGGTGGACCGGA TGTTCC, and reverse, AAC TCACGCGCCAGTAGAAG; TIMP-1, forward, ACTGCAGGA TGGACTCTTGCA, and reverse, TTTCAGAGCCTTGGAGGAGCT. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was served as a control.…”

Section: Methodsmentioning

confidence: 99%

“…10 Morus alba stem extract (MSE) has a wide spectrum of biological properties including anti-inflammatory. 11 12 Recently, the use of natural compounds from plant sources such as alkaloids, flavonoids, and phenolic compounds have shown promising results regarding MMPs inhibition. 13 However, the effect of MSE on MMPs and TIMPs expression in THP-1 cells has so far not been investigated.…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Morus alba Stem Extract Suppresses Matrix Metalloproteinases (MMP)-1, MMP-9, and Tissue Inhibitors of Metalloproteinase (TIMP)-1 Expression via Inhibition of IκBα Degradation Induced by Porphyromonas gingivalis LPS Signal in THP-1 Cells

et al. 2019

Self Cite

View full text Add to dashboard Cite

Objectives The aim of this study is to evaluate the inhibitory effects of M. alba stem extract (MSE) on the expression of matrix metalloproteinases (MMP)-1, MMP-9, and tissue inhibitors of metalloproteinase (TIMP)-1 in Porphyromonas gingivalis lipopolysaccharide (LPS)-activated-acute monocytic leukemia cell line (THP-1). Materials and Methods THP-1 cells were treated with noncytotoxic concentrations of MSE combined with 1 µg/mL of P. gingivalis LPS. The mRNA levels of MMP-1, MMP-9, and TIMP-1 were evaluated via quantitative real-time polymerase chain reaction. The secreted proteins in the culture media were detected by enzyme-linked immunosorbent assay. The degradation of inhibitor of kappa B-alpha (IκBα) protein was tracked by Western blotting. Statistical Analysis Comparisons in experiments were analyzed with analysis of variance followed by Tukey honestly significant difference comparison test. ResultsTwenty and 40 µg/mL of MSE significantly downregulated MMP-1 and MMP-9 genes and protein expression but upregulated the gene expression of TIMP-1 (p < 0.05). P. gingivalis LPS induced degradation of IκBα, while addition of MSE (20 and 40 µg/mL) increased IκBα cytosolic levels. MSE was able to suppress the P. gingivalis LPS-induced MMPs expression and also increased the gene expression of TIMP-1 via the inhibition of the cytoplasmic IκBα degradation in THP-1 cells. Conclusions The present observations suggest that MSE exerted a positive effect on the regulatory mechanism between MMPs and TIMP, which is an important implication for the therapeutic potential of MSE in periodontitis.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Morus alba Stem Extract Suppresses Matrix Metalloproteinases (MMP)-1, MMP-9, and Tissue Inhibitors of Metalloproteinase (TIMP)-1 Expression via Inhibition of IκBα Degradation Induced by Porphyromonas gingivalis LPS Signal in THP-1 Cells

et al. 2019

Self Cite

View full text Add to dashboard Cite

show abstract

“…The previous studies have revealed that marigold petal (Tagetes erecta) has many flavonoids, including patulitrin, which are substrates with antimicrobial activity that effectively to kill bacterial pathogens [18,19]. Furthermore, some studies have reported that both leaves and root of white mulberry extracts can also inhibit Gram-positive and Gramnegative bacteria, including Bacillus cereus, Bacillus subtilis, Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Serratia marcescens, and Agrobacterium tumefaciens [20][21][22][23].…”

Section: Introductionmentioning

confidence: 99%

Antimicrobial activity of marigold (Tagetes erecta), mulberry (Morus indica), and red shallot (Allium ascalonicum) extracts against Streptococcus agalactiae

et al. 2020

View full text Add to dashboard Cite

Background and Aim: The increasing antimicrobial resistance with reduced susceptibility to antimicrobial drugs is becoming a major concern for both human and animal, which raises health morbidity and mortality rate of cases that cannot be treated by antibiotics. Nowadays, there are many efforts to minimize the misuse of antibiotics. This study evaluated the antimicrobial activity of the crude ethanolic extracts of three Thai herbs divided in four groups; petals of marigold (Tagetes erecta), mulberry leaves and root barks (Morus indica), and whole onions of red shallot (Allium ascalonicum) against Streptococcus agalactiae. Materials and Methods: The antimicrobial activity of four groups of the crude extracts using absolute ethanol from three Thai herbs was tested against standard strains of S. agalactiae using the agar well diffusion method. The commercial antibiotics ceftriaxone and erythromycin were used as positive control standards to determine the sensitivity of S. agalactiae. Results: The result showed that all four groups of Thai herbal extract had inhibitory activity against standard strains of S. agalactiae. The inhibitory concentration test values were obtained using the dilution test at 25, 50, and 75 mg/ml. The maximum antimicrobial activity against S. agalactiae was observed in the ethanolic extracts from red shallot extract, followed by leaves of mulberry, petals of marigold, and root barks of mulberry, respectively. Conclusion: The results demonstrated that the crude extract of three Thai herbs had antimicrobial activity inhibiting the growth of S. agalactiae and suggesting that they may be useful in the treatment of S. agalactiae infections in humans and animals.

show abstract

“…Stems extracts have been shown to have anti-inflammatory [37,[105][106][107][108] and antiosteoarthritis [109] effects. Ethanol of M. alba stem extracts (MSEs) has been been found to suppress IL-6 and IL-8 expression in Porphyromonas gingivalis LPS-stimulated hPDL fibroblasts, indicating a possible anti-inflammatory effect.…”

Section: Stemmentioning

confidence: 99%

Pharmacological Activities for Morus alba L., Focusing on the Immunostimulatory Property from the Fruit Aqueous Extract

Chang

Koo²,

Kim

2021

Foods

View full text Add to dashboard Cite

Depending on the extraction method, numerous compounds that have specific pharmacological effects can be obtained from M. alba L. There is a growing scientific interest in health problems related to aging. Efforts to develop safe immune-enhancing pharmaceuticals are increasing. This review aims to summarize and critically discuss the immunity enhancement effects and pharmaceutical efficacy of M. alba L. extracts. The scientific database search was conducted using Google Scholar, Web of Science, and PubMed until May 2021. Additional articles were identified and obtained from references in the retrieved articles. Ethanol or methanol extraction of various parts of M. alba L. identified a large amount of phenols and flavonoids, which are effective for immunosuppression, antioxidants, and cardiovascular diseases, and are antibacterial, and anticancer. Water extraction of M. alba L. enhanced the innate immune response based on immune cell activation. A polysaccharide and an alkaloid related to increased macrophage activity were isolated from M. alba L. fruit extracts. M. alba L. fruit water extracts primarily induced the production of pro-inflammatory substances, in model organisms, via TLR4 in immune cells. Water extracts have been shown to be effective in pathogen defense and tumor suppression by enhancing macrophage activity. Based on our literature review on the bioactivity of M. alba L. fruit extracts, particularly in relation to their immunity enhancement activity, we anticipate that M. alba-derived pharmaceuticals will have excellent potential in future medical research.

show abstract

Antibacterial and Anti-inflammatory Potential of Morus alba Stem Extract

Cited by 16 publications

References 23 publications

Morus alba Stem Extract Suppresses Matrix Metalloproteinases (MMP)-1, MMP-9, and Tissue Inhibitors of Metalloproteinase (TIMP)-1 Expression via Inhibition of IκBα Degradation Induced by Porphyromonas gingivalis LPS Signal in THP-1 Cells

Morus alba Stem Extract Suppresses Matrix Metalloproteinases (MMP)-1, MMP-9, and Tissue Inhibitors of Metalloproteinase (TIMP)-1 Expression via Inhibition of IκBα Degradation Induced by Porphyromonas gingivalis LPS Signal in THP-1 Cells

Antimicrobial activity of marigold (Tagetes erecta), mulberry (Morus indica), and red shallot (Allium ascalonicum) extracts against Streptococcus agalactiae

Pharmacological Activities for Morus alba L., Focusing on the Immunostimulatory Property from the Fruit Aqueous Extract

Contact Info

Product

Resources

About