Antagonistic role of
            <i>vega1</i>
            and
            <i>bozozok/dharma</i>
            homeobox genes in organizer formation

Kawahara, Atsuo; Wilm, Thomas P.; Solnica‐Krezel, Lilianna; Dawid, Igor B.

doi:10.1073/pnas.97.22.12121

Cited by 65 publications

(67 citation statements)

References 34 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…2 L and P and data not shown). Likewise, the expression of other regulators of the DV axis, like the ventralizing homeobox genes vega1͞vega2 (33) or the dorsalizing genes cyclops and squint (34,35), were not affected in morphants (data not shown). We conclude that the dorsalization induced by rdr atgMO and rdr DN is an early phenomenon, and is likely the result of an early reduction of bmp expression rather than the consequence of an increase in the levels of bmp antagonists.…”

Section: Resultsmentioning

confidence: 90%

Maternal induction of ventral fate by zebrafish radar

Sidi

Goutel

Peyriéras

et al. 2003

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

In vertebrate embryos, maternal determinants are thought to preestablish the dorsoventral axis by locally activating zygotic ventral-and dorsal-specifying genes, e.g., genes encoding bone morphogenetic proteins (BMPs) and BMP inhibitors, respectively. Whereas the canonical Wnt͞␤-catenin pathway fulfills this role dorsally, the existence of a reciprocal maternal ventralizing signal remains hypothetical. Maternal noncanonical Wnt͞Ca 2؉ signaling may promote ventral fates by suppressing Wnt͞␤-catenin dorsalizing signals; however, whether any maternal determinant is directly required for the activation of zygotic ventral-specifying genes is unknown. Here, we show that such a function is achieved, in part, in the zebrafish embryo by the maternally encoded transforming growth factor ␤ (TGF-␤) signaling molecule, Radar. Lossof-function experiments, together with epistasis analyses, identify maternal Radar as an upstream activator of bmps expression. Maternal induction of bmps by Radar is essential for zebrafish development as its removal results in larval-lethal dorsalized phenotypes. Double-morphant analyses further suggest that Radar functions through the TGF-␤ receptor Alk8 to initiate the expression of bmp genes. Our results support the existence of a previously uncharacterized maternal ventralizing pathway. They might further indicate that maternal TGF-␤͞Rdr and Wnt͞Ca 2؉ pathways complementarily specify ventral cell fates, with the former triggering bmps expression and the latter indirectly repressing genes encoding BMP antagonists.T he degree to which the maternal genome contributes to vertebrate embryogenesis is a classical issue in developmental biology that remains largely unresolved. Pioneering work in amphibians, however, has led to models stressing its importance, especially in the control of early embryonic dorsoventral (DV) patterning (1, 2). Smith (3), for example, advanced a classical model for mesoderm induction that relied, in part, on two maternal signals: (i) a ventralizing signal emanating from ventral vegetal blastomeres inducing ventral mesoderm; and (ii) a reciprocal vegetal dorsalizing signal, inducing the Spemann organizer in the overlying prospective dorsal mesoderm. Since the establishment of this model, substantial efforts have been made to identify the molecules involved in both induction processes.Studies in Xenopus and zebrafish have shown that the Wnt͞ ␤-catenin pathway likely underlies the maternal dorsalizing signal. Members of the pathway, including Dishevelled and ␤-catenin, are dorsally enriched as soon as the first cell cycle of Xenopus development (4, 5). In zebrafish, ␤-catenin and the ichabod (ich) gene product, which ensures nuclear accumulation of ␤-catenin, are essential for dorsal specification. In heterozygous embryos derived from ich homozygous mutant mothers, the activation of zygotic dorsal-specifying genes (e.g., chordino (din)͞chordin, goosecoid, the homeobox gene bozozok (boz)͞ dharma, and the nodal gene squint) is abolished. As a consequence, ich mutants fail to fo...

show abstract

Section: Resultsmentioning

confidence: 90%

Maternal induction of ventral fate by zebrafish radar

Sidi

Goutel

Peyriéras

et al. 2003

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

show abstract

“…To examine a possible requirement for GADD45␤ proteins in somitogenesis, we interfered with their synthesis with the aid of antisense MOs. Although gadd45␤1 and gadd45␤2 are expressed in the YSL and in the involuting mesoderm at the shield stage, respectively, double MO injection did not affect the expression of goosecoid͞gsc (organizer gene) (21), vega1 (complementary expression to gsc) (22), and no tail͞ntl (mesodermal marker) (23) at the shield stage, and epiboly movements during gastrulation were normal (data not shown). However, somite segmentation of embryos injected with both MOs (GADD45␤1-MO; 7.5 ng ϩ GADD45␤2-MO; 7.5 ng) was severely inhibited (85%; n ϭ 71), whereas uninjected (minor somite defects, 3%; n ϭ 100), control MO-injected (15 ng, 5%; n ϭ 92), single GADD45␤1-MO-injected (7.5 ng, 11%; n ϭ 53), or GADD45␤2-MO-injected embryos (7.5 ng, 12%; n ϭ 57) were normally segmented (Fig.…”

Section: Isolation Of Zebrafish Gadd45␤mentioning

confidence: 96%

Zebrafish GADD45 β genes are involved in somite segmentation

Kawahara

Che

Hanaoka

et al. 2004

Proc. Natl. Acad. Sci. U.S.A.

Self Cite

View full text Add to dashboard Cite

Somites in vertebrates are periodic segmented structures that give rise to the vertebrae and muscles of body. Somites are generated from presomitic mesoderm (PSM), but it is not fully understood how cellular differentiation and segment formation are achieved in the anterior PSM. We report here that zebrafish gadd45␤1 and gadd45␤2 genes are periodically expressed as paired stripes adjacent to the neural tube in the anterior PSM region where presomitic cells mature. In mammals, it is known that GADD45 (growth arrest and DNA damage) family proteins play a role in cell-cycle control. We found that both knockdown and overexpression of gadd45␤ genes caused somite defects with different consequences for marker gene expression. Knockdown of gadd45␤ genes with antisense morpholino oligonucleotides caused a broad expansion of mesp-a in the PSM, and both cyclic expression of her1 and segmented expression of MyoD were disorganized. On the other hand, injection of gadd45␤1 or gadd45␤2 suppressed expression of mesp-a and her1 in anterior PSM and MyoD in paraxial mesoderm. These results indicate that regulated expression of gadd45␤ genes in the anterior PSM is required for somite segmentation.presomitic mesoderm ͉ periodicity ͉ patterning ͉ knockdown

show abstract

“…Two zebrafish homeobox genes, vox/vega1 and vent/vega2, encode transcriptional repressors implicated in patterning of the dorsoventral axis (1)(2)(3)(4)(5)(6). The vox also has an important function in regulation of ventral endoderm development and the separation of endoderm from mesoderm and ectoderm (7).…”

Section: Introductionmentioning

confidence: 99%

Expression of vox and vent mRNAs and encoded proteins in zebrafish embryos

Pshennikova

Tereshina

Voronina

2017

Stem Cell Investig.

View full text Add to dashboard Cite

Abstract:In Danio rerio (zebrafish), members of the vent gene-family (vox/vega1, vent/vega2) are considered as ventralizing factors. We investigated not only the expression of their mRNAs by in situ hybridization at different stages of embryonic development, but also the spatial distribution of the encoded proteins by whole-mount immunostaining. We showed vox mRNA to be available in embryos since early cleavage and later on. Vent mRNA appeared after zygotic genome activation only. The vox and vent proteins were revealed at stage of eight blastomeres. At blastula and gastrula the vox and vent protein staining areas completely overlapped those of the mRNAs. They were expressed uniformly throughout the embryo except for a small region of clearing on the dorsal side. From the bud stage throughout somitogenesis, the vox and vent proteins staining progressively covered the embryos except for dorsal side: at the bud stage it resembled that of mRNA and at the beginning of somitogenesis it was clearly seen along the axis structures. At the pharyngula period stages the proteins were located in neural crest zone, but their mRNAs appeared to be in the tail tips. Thus during embryogenesis, the spatial distributions of a protein and its mRNA may not always quite coincide. We observed such mismatches in embryos at the cleavage stage and in the pharyngula period. axial structures and around somites. In this study we for the first time compared the patterns of vent-family mRNAs and the encoded proteins in zebrafish embryos at early stages, before and after zygotic genes activation. Keywords Methods Embryo stagesZebrafish embryos developmental stages were identified according to tables (11). Isolation of RNA and RT-PCR analysisZebrafish embryos at stages 1-4 blastomeres were fixed with MEMFA solution (0.1 M MOPS pH 7.4; 2 mM EGTA; 2 mM MgSO 4 ; formaldehyde 3.7%) for 6 hours at room temperature and 12 hours at 4 ℃. Then they were transferred gradually into 70% ethanol and stored at −20 ℃. RNA isolation was performed as in (12). The rehydrated embryos were washed sequentially with 2 M glycine containing 5 mM EDTA pH 8.0 and the buffer for proteinase K (10 mM Tris pH 8.0, 5 mM EDTA, 50 mM NaCl). To the last wash solution 1 mg of proteinase K and 30 mkg of glycogen were added. After incubation at 42 ℃ for 1 h, the sample was supplemented with 1 ml of the solution containing 40 mM Tris pH 7.5, 4% SDS, 0.4 M NaCl, and 10 mM EDTA and incubated for an additional 30 min at 42 ℃ and 30 min at 80 ℃. Then the sample was transferred into a tube, and a standard phenol-chloroform deproteinization was carried on (13). After DNAse treatment the standard phenolchloroform deproteinization was performed again and the isolated RNA was used in the reverse transcription reaction with the primer 5' TTCAGTAGTAATGATGTCTGGGCG 3'. The PCR was performed with this primer and the second primer 5' GAAATCATGGTGAAGAACTTTTCC 3'. The cDNA product was supposed to correspond to a full-length coding region of vox mRNA-736bp. The product of RT-PCR was analyzed by elec...

show abstract

Antagonistic role of vega1 and bozozok/dharma homeobox genes in organizer formation

Cited by 65 publications

References 34 publications

Maternal induction of ventral fate by zebrafish radar

Maternal induction of ventral fate by zebrafish radar

Zebrafish GADD45 β genes are involved in somite segmentation

Expression of vox and vent mRNAs and encoded proteins in zebrafish embryos

Contact Info

Product

Resources

About