Analysis of β Globin Mutations in the Indian Population: Presence of Rare and Novel Mutations and Region Wise Heterogeneity.

Abstract

β-thalassaemia is a major public health problem in India. A comprehensive data base of the spectrum of mutations causing β thalassaemia in the Indian population is necessary. Each population group in which the disease is prevalent has a different spectrum of β globin mutations and a few mutations account for most of the alleles. From 1997 to 2006, β-Globin gene mutation analysis was carried out in 1030 individuals. The common mutations in the population were screened by reverse dot blot (RDB). Deletion of 619 bp of the β globin gene was detected by gap-PCR. Rare mutations were screened using temporal temperature gel electrophoresis (TTGE) and DNA sequencing. Haplotyping of rare mutations was done by using established PCR-RFLP methods. Out of the 1030 individuals, 515 were homozygous or compound heterozygotes. Among the others, 178 had heterozygous β thalassaemia, 292 HbE-βthalassaemia, 27 HbS-β thalassaemia, 3 HPFH-β thalassaemia, 5 Lepore-β thalassaemia and 10 (δβ)0-β thalassaemia. Mutation analysis was performed on a total of 1545 β globin alleles from the subjects included in the study. The regional distribution of study subjects were: 533 from the South (Kerala, Tamilnadu, Andhra Pradesh and Karnataka), 529 from the East (Bihar, Orissa, West Bengal and other eastern states), 233 from the West (Gujarat, Maharashtra, Madhyapradesh and Rajasthan) and 92 from the Northern part of the country (Harayana, Punjab, Uttar Pradesh). A total of 41 mutations including 17 mutations that have not been reported earlier in this population were detected. Four, Codon 62/64 (−7bp), Codon 81/87 (−22bp), −25 (A→G) and IVS II- 613 (C→T) are novel mutations causing β thalassaemia. Thirteen mutations, which were detected in other populations but were not reported earlier in the Indian population, were identified. They included −29 (A→G), −87 (C→G), −90 (C→T), Codon 17 (A→T), Codon 22/23/24 (−17 bp), Codon 26 (G→T), Codon 36/37 (−T), Codon 41 (−C), IVS I-129 (A→C), IVS I-130 (G→C), IVS I-130 (G→A), Codon 106/107 (+G) and Codon 110 (T→C). Comparison of the spectrum of β thalassaemia mutations between different regions shows that there are considerable differences in the geographical distribution of mutations in the Indian population (Table). Haplotype analysis revealed that the rare mutations occured denovo and also through population migration. This data will aid in carrier detection, genetic counselling and prenatal diagnosis which play an important role in the prevention of the disease. Regional Distribution of β globin Mutations in India (%) Mutation South East North West IVS I-5(G-C) 57.41 73.51 54.35 49.36 CD 15(G-A) 12.38 6.99 0 3 poly A (T-C) 9 0.73 0 0.86 −28(A-G) 4.5 0 0 0 IVS II-837 (T-G) 2.81 0 0 0 CD 30(G-C) 1.9 7.28 1.09 2.58 CD 41/42(-TCTT) 2.06 3.64 6.52 5.15 619 bp DEL 0 0.44 8.7 20.17 IVS I-1(G-T) 0.9 0.15 11.96 10.73 CD 8/9 (+G) 0.1 1.6 3.26 3 OTHERS 8.94 5.67 14.13 5.15

Evaluation of the genetic basis of phenotypic heterogeneity in north Indian patients with Thalassemia major

“…(22) performed mutation analysis on a total of 1545 beta thalassemia genes using the various techniques described for mutation detection and they could characterize the mutation in 99.99% of the beta globin genes.The commonest mutation noted from India is IVS 1‐5 (G→C) (19–22), which was the highest in our study group (85/260 alleles 32.7%). Highest frequencies of IVS 1‐5 (G→C) are in the Southern states and West Bengal (18, 22). This was followed by Fr 8/9 (+G) (58/260; 22.3%).…”

“…This was followed by Fr 8/9 (+G) (58/260; 22.3%). The frequency of common five Indian mutations ranges from 74.55 to 94% in different parts of India (19–27). We found the five common mutations accounted for 88.5% (230/260 alleles) of the beta thalassemia alleles.…”

“…Edison et al. (22) reported that a significant number of Indian patients carried the mutations Codon 15 (G→A) (7.83%), Codon 30 (G→C) (4.33%) and poly A (T/C) (3.55%), which were earlier thought to be rare or absent in the population. In this study, we had 3/260 alleles (1.2%) of Codon 15 (G→A), 2/260 alleles of Codon 30 (G→C) (0.8%).…”

Haemoglobinopathies in eastern Indian states: a demographic evaluation

“…It is estimated that there are 30-40 million carriers, and 8,000 to 10,000 thalassaemics are born every year in India (Mohanty et al 2013). In contrast to the global frequency of 1.5 %, the average carriers of βthalassaemia trait (BTT) in India comprise 3.3 % of the population (Edison et al 2008;Cousens et al 2010). Though its presence is recorded from different regions of India, the frequency varies widely between 0.5 and 17 % in different geographical regions (Edison et al 2008).…”

Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients

“…The most frequent is initiation codon A>G (3.5%), which was characterized in Japanese (11/387 patients with β‐thal are carriers of this mutation), and had not been identified in any other Latin American population. The IVS1:5 G>C mutation (observed in 0.9% of Mexican β‐thal alleles) is the most frequent in India (63.2%) and has been found in Brazil (2.7%), Argentina (0.7%), and Guadeloupe (11.1%) . The mutation Cd 41/42‐TTCT (0.9% in Mexican population) is common throughout Asia, with a frequency up to 42% in Chinese, and has been reported in Venezuela (1.5%) and Cuba (6.1%) .…”