Analysis of Antibiotic Resistance Genes and its Associated SCC mec Types among Nasal Carriage of Methicillin Resistant Coagulase Negative Staphylococci from Community Settings, Chennai, Southern India

Saravanan, Muthupandian; Perumal, Nagaraj; Mahalingam, Surya Prakash; Dilliappan, Selva Kumar; Krishnan, Padma

doi:10.7860/jcdr/2015/11733.6307

Cited by 17 publications

(21 citation statements)

References 22 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…By contrast, in a study done by Singh et al (57), CoNS isolates with SCCmec types I showed high rates of multidrug resistance. On the other hand, a strong association was observed between SCCmec type I and III and non-β-lactam antibiotics resistance where the overall resistance was found to be more common in type I isolates, probably due to the higher proportion of those particular isolates than isolates with type III (58). These findings can help in observing the antibiotic resistance As known, SCCmec elements represent methicillin resistance.…”

Section: Staphylococcal Cassette Chromosome Mec Types and Their Clinimentioning

confidence: 55%

A Review of Staphylococcal Cassette Chromosome mec (SCCmec) Types in Coagulase-Negative Staphylococci (CoNS) Species

Saber

Jasni

Jamaluddin

et al. 2017

MJMS

View full text Add to dashboard Cite

Section: Staphylococcal Cassette Chromosome Mec Types and Their Clinimentioning

confidence: 55%

A Review of Staphylococcal Cassette Chromosome mec (SCCmec) Types in Coagulase-Negative Staphylococci (CoNS) Species

Saber

Jasni

Jamaluddin

et al. 2017

MJMS

View full text Add to dashboard Cite

“…Staphylococcus epidermidis and Staphylococcus haemolyticus are identified as the most common species isolated from clinical samples [2]. [14] tuf-R CCATTTCAGTACCTTCTGGTAA mecA-F TCCAGATTACAACTTCACCAGG mecA 162 [15] mecA-R CCACTTCATATCTTGTAACG 1272F1 GCCACTCATAACATATGGAA IS1272 415 [16] 1272R1 CATCCGAGTGAAACCCAAA β ATTGCCTTGATAATAGCCYTCT ccrA2-B 937 [16] α3 TAAAGGCATCAATGCACAAACACT IS1272 CGTCTATTACAAGATGTTAAGGATAAT ccrC 518 [16] ccrCR CCTTTATAGACTGGATTATTCAAAATAT (MDR) isolates (resistant to three or more of antimicrobials) were estimated according to previously described definitions [13]. Staphylococcus aureus ATCC 29213 and ATCC 33591 were used as control strains.…”

Section: Introductionmentioning

confidence: 99%

Investigation of SCCmec types I–IV in clinical isolates of methicillin-resistant coagulase-negative staphylococci in Ahvaz, Southwest Iran

et al. 2020

View full text Add to dashboard Cite

Today methicillin resistant coagulase-negative staphylococci (MR-CoNS) are important in terms of causing significant nosocomial infections. Besides, MR-CoNS are confirmed as the reservoir of SCCmec elements that carry mecA (methicillin-resistant) gene. Hence, the present study was designed to evaluate the susceptibility pattern, prevalence and diversity of SCCmec types I, II, III, and IV in MR-CoNS strains. In this cross-sectional study, 44 clinical isolates of MR-CoNS were identified using the cefoxitin disc method and further confirmation by polymerase chain reaction (PCR) amplification of the mecA gene. Antimicrobial susceptibility of isolates was investigated by disc diffusion. The identification of CoNS was done by amplification and sequencing of the tuf gene. Multiplex PCR method was done for the determination of SCCmec types. In the present study, the Staphylococcus epidermidis and Staphylococcus haemolyticus were the most predominant isolates with a prevalence of 45.4%. The highest resistance rates were observed against erythromycin (84.1%) and clindamycin (75%). Multiplex PCR revealed the SCCmec type I as the predominant type in the present study. Our study showed that there was no significant relationship between the presence of different types of SCCmec elements and resistance to antibiotics. The present study highlighted a frequent prevalence of MR-CoNS harboring SCCmec type genes in Ahvaz, southwest of Iran. Thus, the molecular typing and periodical monitoring of their drug resistance pattern should be considered in national stewardship programs to designing useful antibiotic prescription strategies.

show abstract

“…Methicillin resistance is a serious health concern since it has spread among Staphylococcus aureus and coagulase-negative Staphylococci (CoNS) that are frequent community and nosocomial pathogens worldwide. [ 1 2 ] Methicillin-resistant strains are often resistant to other classes of antibiotics making their treatment difficult. [ 2 ] In the recent years, the need for new antimicrobial agents because of the rise in antibiotic resistance has led to a search for alternative sources of antimicrobials.…”

Section: Introductionmentioning

confidence: 99%

“…[ 1 2 ] Methicillin-resistant strains are often resistant to other classes of antibiotics making their treatment difficult. [ 2 ] In the recent years, the need for new antimicrobial agents because of the rise in antibiotic resistance has led to a search for alternative sources of antimicrobials. [ 3 ] Medicinal plants offer a wide range of biodiversity of great value for pharmacology.…”

Section: Introductionmentioning

confidence: 99%

Assessment of In vitro antibacterial activity and cytotoxicity effect of Nigella sativa oil

Uğur¹,

Dagi

Öztürk

et al. 2016

Phcog Mag

View full text Add to dashboard Cite

Background:Methicillin resistance is a serious health concern since it has spread among Staphylococcus aureus and coagulase-negative Staphylococci (CoNS) that are frequent community and nosocomial pathogens worldwide. Methicillin-resistant strains are often resistant to other classes of antibiotics, making their treatment difficult. Nigella sativa oil is known to be active against Gram-positive cocci, yet its in vitro cytotoxicity is rarely investigated, is a proper and powerful candidate for treatment of methicillin-resistant isolates.Objectives:The aim of this study is to evaluate the in vitro antibacterial activity and cytotoxicity effect of N. sativa oil.Materials and Methods:The minimal inhibitory concentrations (MICs) of N. sativa oil were determined by broth microdilution method against four different American Type Culture Collection strains, 45 clinical isolates of methicillin-resistant S. aureus (MRSA), and 77 methicillin-resistant CoNS (MRCoNS). The effects of different dilutions (0.25 μg/mL, 0.5 μg/mL, and 1 μg/mL) of N. sativa oil on the proliferation of gingival fibroblasts were evaluated.Results:The MIC values of N. sativa oil against clinical isolates of Staphylococci were between <0.25 μg/mL and 1.0 μg/mL. Compared to the control group, there was no cytotoxic effect on the proliferation of the gingival fibroblasts.Conclusion:In the present study, the oil of N. sativa was very active against MRSA and MRCoNS and had no in vitro cytotoxicity at relevant concentrations. These findings emphasize that there is a requirement for further clinical trials on N. sativa oil for “safe” medical management of infections caused by methicillin-resistant Staphylococci.SUMMARY The minimal inhibitory concentration (MIC) values of Nigella sativa oil against Staphylococcus aureus American Type Culture Collection (ATCC) 29213, Enterococcus faecalis ATCC 29212, Escherichia coli ATCC 25922, and Pseudomonas aeruginosa ATCC 27853 standard strains were 0.5 μg/mL, 2 μg/mL, 64 μg/mL, and 64 μg/mL, respectivelyThe N. sativa oil showed an excellent antibacterial activity against clinical isolates of methicillin-resistant S. aureus and methicillin-resistant coagulase-negative Staphylococci with very low MIC range of <0.25–1.0 µg/mLThe N. sativa oil exhibited no cytotoxic effect on the proliferation of the gingival fibroblasts. Abbreviation used: ATCC: American Type Culture Collection; CLSI: Clinical and Laboratory Standards Institute; CoNS: Coagulase-negative Staphylococci; DMEM: Dulbecco's modified Eagle's medium; DMSO: Dimethyl sulfoxide; FBS: Fetal bovine serum; HGF: Human gingival fibroblast; MIC: Minimal inhibitory concentration; MRCoNS: Methicillin-resistant CoNS; MRSA: Methicillin-resistant S. aureus

show abstract

Analysis of Antibiotic Resistance Genes and its Associated SCC mec Types among Nasal Carriage of Methicillin Resistant Coagulase Negative Staphylococci from Community Settings, Chennai, Southern India

Cited by 17 publications

References 22 publications

A Review of Staphylococcal Cassette Chromosome mec (SCCmec) Types in Coagulase-Negative Staphylococci (CoNS) Species

A Review of Staphylococcal Cassette Chromosome mec (SCCmec) Types in Coagulase-Negative Staphylococci (CoNS) Species

Investigation of SCCmec types I–IV in clinical isolates of methicillin-resistant coagulase-negative staphylococci in Ahvaz, Southwest Iran

Assessment of In vitro antibacterial activity and cytotoxicity effect of Nigella sativa oil

Contact Info

Product

Resources

About