Analysis of a Meiosis-Specific URS1 Site: Sequence Requirements and Involvement of Replication Protein A

106

146

A key transition in meiosis is the exit from prophase and entry into the nuclear divisions, which in the yeast Saccharomyces cerevisiae depends upon induction of the middle sporulation genes. Ndt80 is the primary transcriptional activator of the middle sporulation genes and binds to a DNA sequence element termed the middle sporulation element (MSE). Sum1 is a transcriptional repressor that binds to MSEs and represses middle sporulation genes during mitosis and early sporulation. We demonstrate that Sum1 and Ndt80 have overlapping yet distinct sequence requirements for binding to and acting at variant MSEs. Whole-genome expression analysis identified a subset of middle sporulation genes that was derepressed in a sum1 mutant. A comparison of the MSEs in the Sum1-repressible promoters and MSEs from other middle sporulation genes revealed that there are distinct classes of MSEs. We show that Sum1 and Ndt80 compete for binding to MSEs and that small changes in the sequence of an MSE can yield large differences in which protein is bound. Our results provide a mechanism for differentially regulating the expression of middle sporulation genes through the competition between the Sum1 repressor and the Ndt80 activator.

Section: Methodsmentioning

confidence: 99%

Sum1 and Ndt80 Proteins Compete for Binding to Middle Sporulation Element Sequences That Control Meiotic Gene Expression

Pierce

Benjamin

Montaño

et al. 2003

106

146

“…The construction of pAV124 and pJX43 was described previously (9,26). pMP192 was constructed by PCR amplifying the SUM1 ORF, including the promoter region, and cloning it into a vector containing 13 Myc epitope tags.…”

Section: Methodsmentioning

confidence: 99%

Rfm1, a Novel Tethering Factor Required To Recruit the Hst1 Histone Deacetylase for Repression of Middle Sporulation Genes

McCord

Pierce

Xie

et al. 2003

115

Transcriptional repression is often correlated with the alteration of chromatin structure through modifications of the nucleosomes in the promoter region, such as by deacetylation of the N-terminal histone tails. This is presumed to make the promoter region inaccessible to other regulatory factors and the general transcription machinery. To accomplish this, histone deacetylases are recruited to specific promoters via DNA-binding proteins and tethering factors. We have previously reported the requirement for the NAD ؉ -dependent histone deacetylase Hst1 and the DNA-binding protein Sum1 for vegetative repression of many middle sporulation genes in Saccharomyces cerevisiae. Here we report the identification of a novel tethering factor, Rfm1, that is required for Hst1-mediated repression. Rfm1 interacts with both Sum1 and Hst1 and is required for the Sum1-Hst1 interaction. DNA microarray and Northern blot analyses showed that Rfm1 is required for repression of the same subset of Sum1-repressed genes that require Hst1. These results suggest that Rfm1 is a specificity factor that targets the Hst1 deacetylase to a subset of Sum1-regulated genes.

“…A DNA fragment constructed by annealing the oligonucleotides 5Ј-CGCGGGAC GTACAAGGACGACGATGACAAGA and 5Ј-CGCGTCTTGTCATCGTCG TCCTTGTAGTCC was cloned into the MluI site, and the orientation resulting in the addition of TRDYKDDDDKTR (12 amino acids) containing the Flag epitope sequence at the Mer3 C terminus was confirmed by DNA sequencing. A putative URS1 element, which may repress the transcription in vegetatively growing yeast cells (17), present at position 109 to 117 (AGCCGCCAA) in the MER3 open reading frame (ORF), was changed by site-directed mutagenesis to AGTCGACAA, which did not change the Mer3 amino acid sequence. The resulting 3.6-kb XhoI-HindIII fragment containing MER3-FLAG with the mutated URS1 was cloned between the XhoI and HindIII sites of pRDK249 containing a GAL10 promoter, a 2 m origin, and the URA3 marker (28), yielding pRDK4156.…”

Section: Methodsmentioning

confidence: 99%

Saccharomyces cerevisiae Mer3 Is a DNA Helicase Involved in Meiotic Crossing Over

Nakagawa

Kolodner

2002

Crossing over is regulated to occur at least once per each pair of homologous chromosomes during meiotic prophase to ensure proper segregation of chromosomes at the first meiotic division. In a mer3 deletion mutant of Saccharomyces cerevisiae, crossing over is decreased, and the distribution of the crossovers that occur is random. The predicted Mer3 protein contains seven motifs characteristic of the DExH box type of DNA/RNA helicases. The mer3G166D and the mer3K167A mutation, amino acid substitutions of conserved residues in a putative nucleotide-binding domain of the helicase motifs caused a defect in the transition of meiosis-specific double-strand breaks to later intermediates, decreased crossing over, and reduced crossover interference. The purified Mer3 protein was found to have DNA helicase activity. This helicase activity was reduced by the mer3GD mutation to <1% of the wild-type activity, even though binding of the mutant protein to single-and double-strand DNA was unaffected. The mer3KA mutation eliminated the ATPase activity of the wild-type protein. These results demonstrate that Mer3 is a DNA helicase that functions in meiotic crossing over.During meiosis, two successive rounds of chromosome segregation take place following a single round of DNA replication. At the first meiotic division (meiosis I), pairs of homologous chromosomes (homologs) are synapsed and then segregated to opposite poles. In the prophase of meiosis I, DNA double-strand breaks (DSBs) are formed in a genetically programmed way, and two types of recombination events occur between homologs (3, 31, 45). Crossing over results in reciprocal exchanges of chromosome arms and serves to link the homologs to ensure proper segregation. The other type of recombination, gene conversion, is defined as nonreciprocal exchange of genetic information. To ensure that every pair of homologs sustains at least one crossover, the distribution of crossovers along and among chromosomes is regulated. The regulation of the distribution of crossovers along a chromosome is inferred from the observation of crossover interference, where multiple crossovers are less frequent than expected based on the frequency of single crossovers (38). The distribution of crossovers along and among chromosomes likely represents different manifestations of the same underlying regulation (10,13,29,58). Despite the fact that crossing over is a key process required for faithful segregation of chromosomes during meiosis, the molecular mechanism of the process and its regulation remain elusive.In Saccharomyces cerevisiae, there are a number of genes required for normal frequencies of crossing over that are not required for gene conversion, including ZIP1, ZIP2, ZIP3, MSH4, MSH5, MLH1, MLH3, and MER3 (1,11,25,26,41,47,57,63). In addition to being required for normal frequencies of crossing over, ZIP1 and MER3 appear to be required to regulate the distribution of crossovers (41, 58). Meiosis-specific DSBs appear for a prolonged period of time in the absence of ZIP1 and MER3, suggest...