An improved primer for PCR amplification of mitochondrial DNA in a variety of insect species

Roehrdanz, Richard L.

doi:10.1111/j.1365-2583.1993.tb00129.x

Cited by 72 publications

(32 citation statements)

References 8 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Sequences were obtained either from the literature or generated from the superfamilies that appear in Table 1. For the COI gene fragment, genomic DNA was extracted and amplified (Dowton and Austin 1994a) with the primers COI-RLR (Roehrdanz 1993) and COI-MD (5Ј-ATTGCAAATACTGCACCTAT-3Ј). These primers anneal to nucleotides 2496-2515 (COI-RLR) and 2934-2953 (COI-MD) of the honeybee mitochondrial genome (Crozier and Crozier 1993).…”

Section: Methodsmentioning

confidence: 99%

Evidence for AT-Transversion Bias in Wasp (Hymenoptera: Symphyta) Mitochondrial Genes and Its Implications for the Origin of Parasitism

Dowton

Austin

1997

J Mol Evol

View full text Add to dashboard Cite

We inferred the incidence of nucleotide conversions in the COI and 16S rRNA mitochondrial genes of members of the Symphyta and basal Apocrita (Hymenoptera). Character-state reconstructions in both genes suggested that conversions between A and T (AT transversions) occurred much more frequently than any other type of change, although we cannot wholly discount an underlying transition bias. Parsimony analysis of COI nucleotide characters did not recover phylogeny; e.g., neither the Tenthredinoidea nor Apocrita were recovered as monophyletic. However, analysis of COI amino acid characters did recover these relationships, as well as others based on fossil and morphological evidence. Analysis of 16S rRNA characters also recovered these relationships providing conversions between A and T were down-weighted. Analysis of the combined data sets gave relatively strong support for various relationships, suggesting that both data sets supported similar topographies. These data sets, both separately and combined, suggested that the phytophagous Siricidae were more closely related to the predominantly parasitic Apocrita than were the ectoparasitic Orussoidea. This suggests that the wasp parasitic lifestyle did not have a single origin, unless the Siricidae have more recently reverted to phytophagy. Alternatively, parasitism evolved twice independently, once in the Orussoidea and again in the Apocrita. The latter scenario is supported by the observation that the evolution of parasitism was accompanied by a tendency for the larvae to develop inside plant tissues. Adaptations that accompanied the movement of wasps into a confined, wood-boring habitat may have preadapted them to becoming ectoparasitic.

show abstract

Section: Methodsmentioning

confidence: 99%

Evidence for AT-Transversion Bias in Wasp (Hymenoptera: Symphyta) Mitochondrial Genes and Its Implications for the Origin of Parasitism

Dowton

Austin

1997

J Mol Evol

View full text Add to dashboard Cite

show abstract

“…1,620 bp fragment of mtDNA that included portions of cytochrome c oxidase I (COI) and II (COII) genes and the interval between them that contains the tRNA Leu-UUR gene. Using primers COI-Croz and COII-Croz (Roehrdanz, 1993), a polymerase chain reaction was performed for 30 cycles (30 s at 93°C, 60 s at 47°C, 120 s at 72°C) after 3 min at 93°C. For all reactions, a negative control was added to prevent contamination.…”

Section: Methodsmentioning

confidence: 99%

Geographical structuring of mitochondrial DNA in Semanotus japonicus (Coleoptera: Cerambycidae)

Shoda

Kubota

Machida

2003

Appl. Entomol. Zool.

View full text Add to dashboard Cite

“…The Mt DNA COI-tRNA Leu -COII fragment was amplified from individual weevils using the primer pair COI-RLR (5 0 TTGATTTTTTGGTCATCCAGAAGTTTATA3 0 ) and COII-Croz (5 0 CCACAAATTTCTGAACATTGACC3 0 ) (Roehrdanz 1993 …”

Section: Dna Extractionmentioning

confidence: 99%

Male biased gene flow in banana pseudostem weevil (Odoiporus longicollis Oliver) as revealed by analysis of the COI-tRNALeu COII region

2015

View full text Add to dashboard Cite

The genetic diversity amongst thirty weevils representing six Indian populations of banana pseudostem weevil, i.e., Odoiporus longicollis (Oliver) was estimated by sequence analysis of the partial COI-tRNA(Leu)-COII region. The sequences exhibited AT bias typical of insect mitochondrial DNA which was highest in the first codon position of COI and in the third codon position of COII. There was no phylogeographic distribution of the populations. The Fu and Li's D and F tests were non-significant for this mitochondrial region. No Wolbachia infection was detected in any of the populations. The genetic differentiation amongst the populations was highly significant (p < 0.001; χ2 = 123.333; df = 75), suggesting restricted gene flow between the populations. This result did not correlate with that obtained with nuclear rDNA markers, i.e., ITS1 and ITS2, suggesting a male biased gene flow between the populations.

show abstract

An improved primer for PCR amplification of mitochondrial DNA in a variety of insect species

Cited by 72 publications

References 8 publications

Evidence for AT-Transversion Bias in Wasp (Hymenoptera: Symphyta) Mitochondrial Genes and Its Implications for the Origin of Parasitism

Evidence for AT-Transversion Bias in Wasp (Hymenoptera: Symphyta) Mitochondrial Genes and Its Implications for the Origin of Parasitism

Geographical structuring of mitochondrial DNA in Semanotus japonicus (Coleoptera: Cerambycidae)

Male biased gene flow in banana pseudostem weevil (Odoiporus longicollis Oliver) as revealed by analysis of the COI-tRNALeu COII region

Contact Info

Product

Resources

About