An engineered fatty acid synthase combined with a carboxylic acid reductase enables de novo production of 1-octanol in Saccharomyces cerevisiae

Abstract

BackgroundThe ideal biofuel should not only be a regenerative fuel from renewable feedstocks, but should also be compatible with the existing fuel distribution infrastructure and with normal car engines. As the so-called drop-in biofuel, the fatty alcohol 1-octanol has been described as a valuable substitute for diesel and jet fuels and has already been produced fermentatively from sugars in small amounts with engineered bacteria via reduction of thioesterase-mediated premature release of octanoic acid from fatty acid synthase or via a reversal of the β-oxidation pathway.ResultsThe previously engineered short-chain acyl-CoA producing yeast Fas1R1834K/Fas2 fatty acid synthase variant was expressed together with carboxylic acid reductase from Mycobacterium marinum and phosphopantetheinyl transferase Sfp from Bacillus subtilis in a Saccharomyces cerevisiae Δfas1 Δfas2 Δfaa2 mutant strain. With the involvement of endogenous thioesterases, alcohol dehydrogenases, and aldehyde reductases, the synthesized octanoyl-CoA was converted to 1-octanol up to a titer of 26.0 mg L−1 in a 72-h fermentation. The additional accumulation of 90 mg L−1 octanoic acid in the medium indicated a bottleneck in 1-octanol production. When octanoic acid was supplied externally to the yeast cells, it could be efficiently converted to 1-octanol indicating that re-uptake of octanoic acid across the plasma membrane is not limiting. Additional overexpression of aldehyde reductase Ahr from Escherichia coli nearly completely prevented accumulation of octanoic acid and increased 1-octanol titers up to 49.5 mg L−1. However, in growth tests concentrations even lower than 50.0 mg L−1 turned out to be inhibitory to yeast growth. In situ extraction in a two-phase fermentation with dodecane as second phase did not improve growth, indicating that 1-octanol acts inhibitive before secretion. Furthermore, 1-octanol production was even reduced, which results from extraction of the intermediate octanoic acid to the organic phase, preventing its re-uptake.ConclusionsBy providing chain length control via an engineered octanoyl-CoA producing fatty acid synthase, we were able to specifically produce 1-octanol with S. cerevisiae. Before metabolic engineering can be used to further increase product titers and yields, strategies must be developed that cope with the toxic effects of 1-octanol on the yeast cells.

Fusing α and β subunits of the fungal fatty acid synthase leads to improved production of fatty acids

“…2B). In addition to the deletion of genomic FAS1 and FAS2 copies, FAA2 gene encoding the medium chain fatty acyl-CoA synthetase was deleted in this strain to minimize degradation of octanoic acid via β-oxidation as described previously 15,20 . fusFAS RK expression resulted in a higher accumulation of extracellular OA compared to the two-gene-encoded FAS RK at both time points.…”

“…For this, a donor DNA together with the CRISPR-Cas9 plasmid encoding for the Cas9 and the guide RNA with a protospacer sequence targeting specifically FAA2 (GAAGATTTTGAAACCTTACG) was transformed into yeast cells. The strain SHY34 resulted from the previously described strain RPY21 15 by deletion of two kanMX4 markers which were present in the RPY21 genome as remnants of FAS1 and FAS2 deletion by the same CRISPR-procedure (pRCC-N-kanMX4; protospacer sequence: TTACTCACCACTGCGATCCC). RPY21 has a BY background and is based on strain BY.PK1238_1A_KO 12 , in which FAA2 was previously deleted 15 as described above for SHY24.…”

“…compound extraction and derivatization. Extraction of free fatty acids in the culture medium was performed as described before 15 . Cells were separated from the medium by centrifugation (3,500 rcf, 10 min) and 10 ml of culture supernatant was mixed with an internal standard (0.2 mg heptanoic acid), 1 mL of 1 M HCl and 2.5 ml of methanol:chloroform (1:1) solution.…”

A Yeast-Based Biosensor for Screening of Short- and Medium-Chain Fatty Acid Production

“…To prove the functionality of the biosensor in culture supernatants, we used a previously constructed S. cerevisiae strain (RPY21/FAS R1834K ) that produces mainly C 8 FA, which is secreted from or diffuses out of the cells. 25 Characterization and Verification of Functionality of the Biosensor. We analyzed the biosensor response to C 8 FA concentrations between 0 and 1 mM for an initial validation in defined medium (SCD).…”

“…FA extraction and GC analysis were performed as described previously. 25 For each culture, two 10 mL aliquots from the same culture supernatant were separately processed and measured by GC. The standard deviation (SD) between the two measurements from the same culture was for all samples below 2 mg/L.…”