An economically and environmentally acceptable synthesis of chiral drug intermediate l-pipecolic acid from biomass-derived lysine via artificially engineered microbes

Abstract

Deficiency in petroleum resources and increasing environmental concerns have pushed a bio-based economy to be built, employing a highly reproducible, metal contaminant free, sustainable and green biomanufacturing method. Here, a chiral drug intermediate L-pipecolic acid has been synthesized from biomass-derived lysine. This artificial bioconversion system involves the coexpression of four functional genes, which encode L-lysine α-oxidase from Scomber japonicus, glucose dehydrogenase from Bacillus subtilis, Δ-piperideine-2-carboxylase reductase from Pseudomonas putida, and lysine permease from Escherichia coli. Besides, a lysine degradation enzyme has been knocked out to strengthen the process in this microbe. The overexpression of LysP improved the L-pipecolic acid titer about 1.6-folds compared to the control. This engineered microbial factory showed the highest L-pipecolic acid production of 46.7 g/L reported to date and a higher productivity of 2.41 g/L h and a yield of 0.89 g/g. This biotechnological L-pipecolic acid production is a simple, economic, and green technology to replace the presently used chemical synthesis.

Enhanced 5‐aminovalerate production in Escherichia coli from l‐lysine with ethanol and hydrogen peroxide addition

“…The yield of 5AVA also was increased from 0.038 to 0.050 g g −1 for CJ02. Moreover, the endogenous production of l ‐lysine could not be detected for wild‐type strains . The engineered E. coli strains of knockout of CadA could produce 0.32 g L −1 of l ‐lysine.…”

“…First, a key enzyme in the lysine degradation pathway, referred to as cadA , was knocked out to decrease lysine degradation, thus further increasing the metabolic flux to 5AVA. Furthermore, l ‐lysine hydrochloride ( l ‐lysine HCl) was selected as a better substrate than l ‐lysine . It had the potential to accelerate the transportation of l ‐lysine from fermentation broth into the cell plasma, and eliminate the restriction of the substrate supplementation.…”

“…E.coli DH5α was used for general cloning and plasmid construction. The cadA gene deletion was conducted in BL21 (DE3) using the two steps of homologous recombination . The raiP from Scomber japonicus was codon‐optimized by the OptimumGene™ Gene Design system, chemically synthesized and inserted in pUC57 to yield pUC57‐ raiP (Genewiz Co., Suzhou, China).…”

“…The raiP from Scomber japonicus was codon‐optimized by the OptimumGene™ Gene Design system, chemically synthesized and inserted in pUC57 to yield pUC57‐ raiP (Genewiz Co., Suzhou, China). The nucleotide sequence of the synthetic raiP gene is available in the DDBJ/EMBL/GenBank databases under the accession number MG423617 . Then the raiP ‐coding region was amplified from pUC57‐ raiP by PCR using the primers Nde I‐ raiP ‐ Bam HI‐F (5′‐GGAATTCCATATGGAGCACCTGGCAGACTGTCTGG‐3′) with an Nde I restriction site and Nde I‐ raiP ‐ Bam HI‐R (5′‐CGGGATCCCAGTTCGTCCTTGGTATGC‐3′) with a Bam HI restriction site (Table ).…”

Cell-free biocatalytic syntheses of l-pipecolic acid: a dual strategy approach and process intensification in flow

“…25 In another example of whole cell production, Cheng et al achieved a higher yield (46.7 g L −1 ) over 36 h fermentations by creating and artificial pathway, co-expressing 4 recombinant proteins in E. coli. 26 However, many biocatalytic methods are still far from meeting industrial requirements, and chemical methods offering higher yields are often preferred. 27 Interestingly, from an enzymatic perspective, even though the first reaction in the synthesis of PA from L-lysine consists of a deamination, no transaminase based approach has been described to date, albeit lysine-ε-aminotransferases have been identified in bacteria, fungi and animals, and even some ω-transaminases have shown activity with lysine.…”