An antibody reactive to the Gly63–Lys68 epitope of NT-proBNP exhibits O-glycosylation-independent binding

Abstract

The N-terminal fragment of prohormone brain natriuretic peptide (NT-proBNP) is a commonly used biomarker for the diagnosis of congestive heart failure, although its biological function is not well known. NT-proBNP exhibits heavy O-linked glycosylation, and it is quite difficult to develop an antibody that exhibits glycosylation-independent binding. We developed an antibody that binds to the recombinant NT-proBNP protein and its deglycosylated form with similar affinities in an enzyme immunoassay. The epitope was defined as Gly63–Lys68 based on mimetic peptide screening, site-directed mutagenesis and a competition assay with a peptide mimotope. The nearest O-glycosylation residues are Thr58 and Thr71; therefore, four amino acid residues intervene between the epitope and those residues in both directions. In conclusion, we report that an antibody reactive to Gly63–Lys68 of NT-proBNP exhibits O-glycosylation-independent binding.

A phosphorylation pattern-recognizing antibody specifically reacts to RNA polymerase II bound to exons

“…Recombinant pCEP4 was transfected into HEK 293F cells using 25-kDa linear polyethylenimine (Polysciences, Warrington, PA, USA) as previously described. 16 Overexpressed scFv-Fc fusion proteins were purified by affinity chromatography using protein A Sepharose columns (Repligen, Waltham, MA, USA) according to the manufacturer's instructions.…”

The level of decoy epitope in PCV2 vaccine affects the neutralizing activity of sera in the immunized animals

“…The gene encoding the selected scFv clone was subcloned into a modified mammalian expression vector encoding the C k domain of human IgG at the 3 0 region [25]. The scFv-C k fusion protein (anti-CP 169e180 antibody) was purified from the culture supernatants of transiently transfected HEK293F cells using KappaSelect resin (GE Fig.…”

“…BP-2015-030-2). After the collection of sera from PCV2infected pigs and pigs with no infection history, the competition enzyme immunoassay was performed as described previously with the following appropriate modifications [25]. After pre-incubating non-infected and infected porcine sera (n ¼ 3/group) with serially diluted anti-CP 169e180 antibody, the mixtures were added to microtiter plate coated with BSA-conjugated CP 169e180 peptide.…”

Establishment of a mammalian expression system for recombinant [–2]proPSA and a specific antibody against the truncated leader peptide

“…The genes encoding [-2]proPSA, [-7]proPSA, and PSA were isolated by PCR using 5 -CCCAAGCTTATGTGGGTCCCGGTTGTCTTCCTCACCCTGTCCGT GACGTGGA TTGGCGCTGCGCCCCTCATCCTGTCTCGG-3 , 5 -CC CAAGCTTATGTGGGTCCCGGTTGTC TTCCTCACCCTGTCCGTGA CGTGGATTGGCGCTTCTCGGATTGTGGGAGGCTGG-3 , and 5 -CCCAAGCTTATGTGGGTCCCGGTTGTCTTCCTCACCCTGTCCGT GACGTGGATTGGCGCTATTGTGGGGGCTGGGAGTGC-3 with the HindIII restriction site (underlined) as reverse primer, respectively, and 5 -CTGGCCGGCCTGGCCGGGGTTGGCCACGATGGT GTC-3 with the SfiI restriction site (underlined) as a forward primer. The amplified genes were digested with HindIII and SfiI restriction enzymes (both from New England BioLabs, Ipswich, MA, USA) and were ligated into a pCEP4 expression vector (Invitrogen, Carlsbad, CA, USA) that was modified to contain the human C κ domain using T4 DNA ligase (Invitrogen) as reported previously [15]. HEK 293F cells (Invitrogen) were cultured in GIBCO FreeStyle TM 293 Expression media containing 10,000 IU/L penicillin and 100 mg/L streptomycin (Invitrogen) at 37 • C in an orbital shaking incubator (Minitron; INFORS HT, Bottmingen, Switzerland) with 7% CO 2 at 135 rpm.…”