Affinity Chromatography‐Based Assays for the Screening of Potential Ligands Selective for G‐Quadruplex Structures

Abstract

DNA G‐quadruplexes (G4s) are key structures for the development of targeted anticancer therapies. In this context, ligands selectively interacting with G4s can represent valuable anticancer drugs. Aiming at speeding up the identification of G4‐targeting synthetic or natural compounds, we developed an affinity chromatography‐based assay, named G‐quadruplex on Oligo Affinity Support (G4‐OAS), by synthesizing G4‐forming sequences on commercially available polystyrene OAS. Then, due to unspecific binding of several hydrophobic ligands on nude OAS, we moved to Controlled Pore Glass (CPG). We thus conceived an ad hoc functionalized, universal support on which both the on‐support elongation and deprotection of the G4‐forming oligonucleotides can be performed, along with the successive affinity chromatography‐based assay, renamed as G‐quadruplex on Controlled Pore Glass (G4‐CPG) assay. Here we describe these assays and their applications to the screening of several libraries of chemically different putative G4 ligands. Finally, ongoing studies and outlook of our G4‐CPG assay are reported.

Selective Targeting of Cancer-Related G-Quadruplex Structures by the Natural Compound Dicentrine

“…The G4-CPG assay is an affinity chromatography-based method conceived to improve the previously developed G-quadruplex on Oligo Affinity Support (G4-OAS) [ 11 , 26 , 27 ], allowing for the rapid and easy selection of G-quadruplex-specific ligands. It involves flowing solutions of putative G-quadruplex ligands through a Controlled Pore Glass (CPG) support functionalized with G-quadruplex-forming oligonucleotides.…”

“…The compounds with high affinity for the G-quadruplex are retained, while those with low-to-null affinity are eluted. All the assay steps are monitored with UV measurements [ 10 , 11 ]. The two following cancer-related G-quadruplex-forming DNA sequences were chosen here as targets: (i) tel 26 , a 26-mer oligonucleotide of sequence d(TTAGGGTTAGGGTTAGGGTTAGGGTT), able to fold into a hybrid G-quadruplex, with its sequence extracted from the human 3′-telomeric overhang [ 28 ], and (ii) c-myc, a 33-mer oligonucleotide able to fold into a parallel G-quadruplex of sequence d(TGGGGAGGGTGGGGAGGGTGGGGAAGGTGGGGA), reproducing the regulatory region of the gene coding for the transcription factor C-MYC [ 29 ].…”

“…The detailed general procedure adopted for the assays is described as follows: weighed amounts of the nude CPG and G-quadruplex-/duplex-functionalized CPG supports (ca. 8 mg) were left in contact with 300 μL of the compound solution in a polypropylene column (4 mL volume, Alltech) equipped with a polytetrafluoroethylene frit (10 μm porosity), a stopcock and a cap [ 10 , 11 ]. After incubation on a vibrating shaker for 4 min, each support was washed with defined volumes of the washing solution (50 mM KCl, 10% DMSO, 10% CH 3 CH 2 OH aq.…”

“…Here, a preliminary screening was carried out with the aid of the G-quadruplex on the Controlled Pore Glass (G4-CPG) assay [ 10 , 11 ] in order to assess the capacity of the examined natural compounds to interact with telomeric and oncogenic G-quadruplexes, as well as their G-quadruplex vs. duplex selectivity. The compound showing the highest affinity and selectivity for the G-quadruplexes, i.e., Dicentrine, was then studied in its interaction in solution with the DNA targets of choice using multiple biophysical techniques.…”

Optimization of G‐Quadruplex Ligands through a SAR Study Combining Parallel Synthesis and Screening of Cationic Bis(acylhydrazones)

“…[19,20] While certain progress in the design of more specific G4 ligands has been achieved during the last years, [21] one of the obstacles is the lack of high-throughput technologies combining the synthesis and biochemical evaluation (profiling) of G4tagerted libraries of putative ligands. In this regard, emerging technologies such as G4-targeted fragment-based screening, [22,23] DNA-encoded chemical libraries, [24] affinity chromatography [25,26] and affinity-selection mass spectrometry, [27,28] or rapid synthesis and evaluation of G4 ligands on a microfluidic platform [29] represent promising alternatives to the classical, robust but time-consuming combinatorial chemistry approaches that rely on the preparative synthesis of putative ligands, followed by their biophysical or biochemical assessment on a one-by-one basis. [30][31][32] Within the chemical space of G4 ligands, quaternary heterocyclic bis(carboxamides) represent one of the oldest and most efficient families.…”