Activation of Transcription by Recombinant Upstream Stimulatory Factor 1 Is Mediated by a Novel Positive Cofactor

Halle, Joern-Peter; Stelzer, Gertraud; Goppelt, Andreas; Meisterernst, Michael

doi:10.1074/jbc.270.36.21307

Cited by 26 publications

(16 citation statements)

References 49 publications

(69 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Thus, it is possible that PSF could likewise increase binding of USF to element AB via a mechanism similar to that by which NonO enhances E47 binding. Similarly, the heatstable protein PC5 has been described as a cofactor that stimulates transcriptional activity of USF (43).…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Cooperative Binding of Upstream Stimulatory Factor and Hepatic Nuclear Factor 4 Drives the Transcription of the Human Apolipoprotein A-II Gene

Ribeiro

Pastier

Kardassis

et al. 1999

Journal of Biological Chemistry

View full text Add to dashboard Cite

The activity of the human apoA-II promoter is controlled by a synergistic interaction of the distal enhancer and the proximal promoter. An important role in apoA-II promoter activity is exerted by a transcription factor, designated CIIIB1, which binds to the proximal element AB and the distal elements of the enhancer, K and L. In the present communication we establish that CIIIB1 corresponds to the previously described factor, upstream stimulatory factor (USF) using the following criteria. (a) Purification of CIIIB1 by affinity chromatography provided a heat-stable protein with an apparent molecular mass of 45 kDa that cross-reacted with anti-USF1 and -USF2a antibodies; (b) CIIIB1 bound to the elements AB, K, and L was supershifted by these antibodies; (c) the heterodimer USF1/2a is the predominant form that corresponds to CIIIB1. Cotransfection experiments in HepG2 cells established the functional significance of USF in apoA-II transcription. It was found that the minimal promoter AB was transactivated by USF2a. In addition, all three E-box motifs present in elements AB, K and L are necessary for maximum transactivation by USF2a. A dominant negative form of USF2a inhibits the activity of apoA-II promoter. The USF1/2a heterodimer, which is naturally expressed in the liver, is as efficient as the USF2a homodimer in the transactivation of apoA-II promoter/enhancer constructs. Cotransfection experiments in COS-1 cells showed that hepatic nuclear factor 4 (HNF-4) synergized with USF2a in the transactivation of the apoA-II promoter. In addition, we showed that HNF-4 and USF2a bind to the enhancer cooperatively. This may account for the transcriptional synergism observed between USF and HNF-4 in the transactivation of the apoA-II promoter.

show abstract

Section: Discussionmentioning

confidence: 99%

“…Human USF was first designated as major late transcription factor (16). Three USF isoforms have been described, USF1, 2a, and 2b, with apparent molecular masses of 43,44, and 38 kDa, respectively (23)(24)(25). USF1 and USF2a and 2b are encoded by two different genes, and USF2a and 2b are generated by differential splicing.…”

mentioning

confidence: 99%

Cooperative Binding of Upstream Stimulatory Factor and Hepatic Nuclear Factor 4 Drives the Transcription of the Human Apolipoprotein A-II Gene

Ribeiro

Pastier

Kardassis

et al. 1999

Journal of Biological Chemistry

View full text Add to dashboard Cite

show abstract

“…Preparation and purification of recombinant or native general transcription factors, TFIIA, TFIIB, TFIID, TFIIE, TFIIF, TFIIH, and RNA polymerase II, and the conditions used for the transcription reactions have been described previously (26,47,70). Transcriptions were conducted in the presence of 100 M all four nucleotides, and transcripts were analyzed by primer extension with an end-labeled primer complementary to the luciferase gene 28 bp downstream of the promoter cloning site with sequence CTTTATGTTTTTGGCGTCTTCCA essentially as described previously (32).…”

Section: Methodsmentioning

confidence: 99%

A Conserved Tissue-Specific Structure at a Human T-Cell Receptor β-Chain Core Promoter

Halle

Haus-Seuffert

Woltering

et al. 1997

Molecular and Cellular Biology

View full text Add to dashboard Cite

The T-cell receptor (TCR) ␤-chain promoters have been characterized as nonstructured basal promoters that carry a single conserved ubiquitous cyclic AMP-responsive element. Our investigation of the human TCR ␤ gene uncovers a surprisingly complex and tissue-specific structure at the TCR V␤ 8.1 promoter. The core of the promoter (positions ؊42 to ؉11) is recognized by the lymphoid cell-specific transcription factors Ets-1, LEF1, and AML1 as well as by CREB/ATF-1, as is demonstrated in gel shift and footprinting experiments. With the exception of LEF1, these factors activate transcription in T cells. Binding sites at the core region show little conservation with consensus sites. Nonetheless, CREB, Ets-1, and AML1 bind and activate cooperatively and very efficiently through the nonconsensus binding sites at the core promoter region. Moderate ubiquitous activation is further induced by CREB/ATF and Sp1 factors through proximal upstream elements. The tissue-specific core promoter structure is apparently conserved in other T-cell-specifically expressed genes such as the CD4 gene. Our observations suggest that both the enhancer and the promoter have a complex tissue-specific structure whose functional interplay potentiates T-cell-specific transcription.T-cell-specific expression of the T-cell receptor (TCR)-CD3 complex and the CD4-CD8 coreceptors depends on distal enhancer elements (8,18,22,29,31,38,46,64,78,80), which is reminiscent of the B-cell-specific regulation of transcription of the immunoglobulin genes (4). The enhancers contain multiple binding sites for ubiquitous, lymphoid cell-and T-cell-specific factors (reviewed in references 9 and 40). Many T-cell-and lymphoid cell-specific factors were initially identified because they bind to functional important elements of the TCR enhancers. Examples are members of the family of high-mobilitygroup (HMG) box-containing factors TCF1 and LEF1 (T-cell factor 1 and lymphoid enhancer binding factor 1) (74,75,77), the zinc finger protein Ikaros (17,49), and the runt domain factor PEBP2␣ (polyomavirus enhancer binding protein 2␣). The latter, also called CBF␣ (core binding factor ␣), is the murine homolog of human AML1 (52), which is involved in the induction of acute myeloid leukemia (reviewed in references 30 and 50). In addition, the lymphoid cell-specific factors Ets-1, Elf-1, and GATA3 as well as the ubiquitous CREB/ATF family bind to and activate the TCR enhancers (16,20,28,43,79,80).Expression of the TCR genes is dependent on distal enhancers (22,38,40,46). Like other tissue-specific and inducible enhancer elements (for reviews, see references 72 and 73), the TCR enhancers assemble the transcription factors in a complex multiprotein structure (19,20). The corresponding promoters are thought to contribute little to tissue-specific transcription of TCR genes (40). For example, sequence comparisons of the different ␤-chain promoters revealed only one conserved element (1, 59, 69). It resembles a cyclic AMPresponsive element (CRE) and is recognized by different members o...

show abstract

“…The ubiquitously expressed factor USF commonly consists of two subunits, USF-1 and USF-2 (26), and has been shown to be a transcriptional activator in combination with other factors (27)(28)(29)(30). For example, in the immunoglobulin heavy chain enhancer, activity is detected only in the presence of a three protein-DNA complex consisting of USF, PU.1, and Ets-1 (15).…”

Section: Discussionmentioning

confidence: 99%

B Cell-specific Activator Protein Prevents Two Activator Factors from Binding to the Immunoglobulin J ChainPromoter until the Antigen-driven Stages of B Cell Development

Wallin¹,

Rinkenberger²,

Rao³

et al. 1999

Journal of Biological Chemistry

View full text Add to dashboard Cite

The immunoglobulin J chain gene is inducibly transcribed in mature B cells upon antigen recognition and a signal from interleukin-2 (IL-2). B cell-specific activator protein (BSAP), a transcription factor that silences J chain transcription, has been identified as a nuclear target of the IL-2 signal. The levels of BSAP progressively decrease in response to IL-2 and this change correlates with the differentiation of B cells into antibody secreting plasma cells. Here we report the binding of the upstream stimulatory factor (USF) to an E-box motif immediately upstream from the BSAP site on the J chain promoter. Mutations in the USF binding motif significantly decrease J chain promoter activity in J chain expressing B cell lines. We also show that a functional relationship exists between USF and a second J chain positive-regulating factor, B-MEF2, using co-immunoprecipitation assays and transfections. Finally, we provide evidence that the binding of BSAP prevents USF and B-MEF2 from interacting with the J chain promoter during the antigen-independent stages of B cell development. It is not until the levels of BSAP decrease during the antigen-driven stages of B cell development that both USF and B-MEF2 are able to bind to their respective promoter elements and activate J chain transcription.During a primary immune response to foreign antigens, mature B cells become activated and differentiate into pentamer IgM-secreting plasma cells. One of the critical events in this process is the synthesis of the immunoglobulin J chain protein required for the assembly and secretion of pentamer IgM antibody (1). Studies of both normal B cells and model B cell lines have shown that J chain synthesis is tightly regulated at the transcriptional level. For efficient J chain transcription to occur, activation signals from both the B cell receptor and the interleukin-2 (IL-2) 1 or IL-5 receptors are needed. Correlating with IL-2/IL-5 induced gene transcription is the appearance of a DNase I-hypersensitive site (bp Ϫ170 to ϩ88) on the J chain promoter of activated B cells (2, 3). The full activity of the J chain promoter is contained within this hypersensitive region, as has been shown using 5Ј deletion mutants in a CAT reporter system (4).Three regulatory elements have been found to be present within this region. These include a T-rich positive regulatory element denoted JA (Ϫ74 to Ϫ60), a purine-rich sequence (Ϫ58 to Ϫ47) denoted JB, and a repressive motif, JC (Ϫ127 to Ϫ110) (5-7). The factor interacting with the JA sequence has recently been identified to be a member of the myocyte enhancer factor-2 (MEF-2) family that is expressed in the B cell lineage, denoted B-MEF2 (5). The JB element has previously been shown to interact with transcription factor PU.1, a member of the Ets family of transcription factors expressed in hematopoietic lineages including monocytes, macrophages, and B lymphoid cells (6). Mutational analyses in J chain positive cell lines have indicated positive regulatory roles for both PU.1 and B-MEF2; base changes tha...

show abstract

Activation of Transcription by Recombinant Upstream Stimulatory Factor 1 Is Mediated by a Novel Positive Cofactor

Cited by 26 publications

References 49 publications

Cooperative Binding of Upstream Stimulatory Factor and Hepatic Nuclear Factor 4 Drives the Transcription of the Human Apolipoprotein A-II Gene

Cooperative Binding of Upstream Stimulatory Factor and Hepatic Nuclear Factor 4 Drives the Transcription of the Human Apolipoprotein A-II Gene

A Conserved Tissue-Specific Structure at a Human T-Cell Receptor β-Chain Core Promoter

B Cell-specific Activator Protein Prevents Two Activator Factors from Binding to the Immunoglobulin J ChainPromoter until the Antigen-driven Stages of B Cell Development

Contact Info

Product

Resources

About