ACE2 gene expression and inflammatory conditions in periodontal microenvironment of COVID-19 patients with and without diabetes evaluated by qPCR

Abstract

Objective Chronic periodontitis has been proposed to be linked to coronavirus disease (COVID-19) on the basis of itsinflammation mechanism. We aimed to evaluate this association by investigating the expression of Angiotensin Converting Enzyme-2 (ACE2) in periodontal compartments, which contain dysbiosis-associated pathogenic bacteria, and how it can be directly or indirectly involved in exacerbating inflammation in periodontal tissue. Material and Methods This observational clinical study included 23 adult hospitalized patients admitted to Universitas Indonesia Hospital with PCR-confirmed COVID-19, while 6 non-COVID-19 participants come to periodontal clinic were included as control. Using real time-PCR (qPCR) and gingival crevicular fluids (GCF) samples from COVID-19 patients with and without diabetes and periodontitis, we assessed the mRNA expression of angiotensin-converting enzyme 2 (ACE2), IL-6, IL8, complement C3, and LL37 as well as the relative proportion of Porphyromonas gingivalis , Fusobacterium nucleatum , and Veillonella parvula to represent the dysbiosis condition in periodontal microenvironment. All analyses were performed to determine their relationship. Results ACE2 mRNA expression was detected in the GCF of periodontitis-COVID-19 patients with and without diabetes. However, only periodontitis-COVID-19 patients with diabetes showed a positive relationship between ACE2 expression and inflammatory conditions in the periodontal microenvironment. In addition, the interplay between pro-inflammatory cytokine (Il-6) and complement C3 could be used as a predictor of the severity of periodontal inflammation in COVID-19 patients with diabetes. Conclusion The study data show that the SARS-CoV-2 entry gene is expressed in the GCF of patients with COVID-19, and its expression correlates with inflammatory markers.

ACE2 expression in saliva of patients with COVID-19 and its association with Candida albicans and Aggregatibacter actinomycetemcomitans

“…Indeed, C. albicans is commonly reported for its relationships with known constituents of the oral biofilm in individuals with and without oral disease. [2][3][4] As dysbiosis of the oral microbiome has been associated with inflammatory conditions in the oral habitat of COVID-19 patients with comorbidity, as reported by Bachtiar et al (preprint), 5 we assumed that fungal-bacterial interactions might also favor the establishment of SARS-CoV-2 infection. Therefore, our objective was to investigate the level of C. albicans, its pathogenicity, and to evaluate its antagonistic relationship with Aggregatibacter actinomycetemcomitans, which is a keystone pathogen associated with periodontitis in adolescents 6 in the saliva of COVID-19 patients with and without diabetes.…”

ACE2 expression in saliva of patients with COVID-19 and its association with Candida albicans and Aggregatibacter actinomycetemcomitans

“…This finding suggests that the bacteria exist as normal microflora in the oral cavity, and they may have been involved in disease processes observed in our patients with COVID-19. 5 The current study highlighted that in the presence of C. albicans , the most abundant gram-negative bacteria in both diseased groups (DG and NDG) were V. parvula , followed by A. actinomycetemcomitans , while F. nucleatum was the least abundant. Moreover, all species can be detected in periodontitis patients with diabetes, 33 but only F. nucleatum and V. parvula have been reported to be positively associated with COVID-19-associated events.…”

“…However, this may explain why the presence of SARS-CoV-2 in the oral cavity favors the emergence and persistence of dysbiosis in another oral niche, including the periodontal microenvironment. 5 Our observations provide additional information, in which there is a strong negative correlation between the “key stone commensal” oral microflora, C. albicans 1 and periodontopathogen, A. actinomycetemcomitans. 37 Interestingly, we found that both C. albicans and A. actinomycetemcomitans showed a positive correlation with ACE2 expression, and a strong correlation was observed in patients with COVID-19 accompanied by diabetes.…”

“…Indeed, C. albicans is commonly reported for its relationships with known constituents of the oral biofilm in individuals with and without oral disease. 2 – 4 As dysbiosis of the oral microbiome has been associated with inflammatory conditions in the oral habitat of COVID-19 patients with comorbidity, as reported by Bachtiar et al (preprint), 5 we assumed that fungal-bacterial interactions might also favor the establishment of SARS-CoV-2 infection. Therefore, our objective was to investigate the level of C. albicans , its pathogenicity, and to evaluate its antagonistic relationship with Aggregatibacter actinomycetemcomitans 6 in the saliva of COVID-19 patients with and without diabetes.…”

“…Bacterial DNA was extracted from the saliva samples with a similar procedure described above. The levels of A. actinomycetemcomitans , F. nucleatum , and V. parvula colonization and the total amount of bacteria in saliva were determined using qPCR with the specific primers, 5 except for A. actinomycetemcomitans , for which we used oligonucleotides as reported elsewhere, 10 as follows: GTGGGGAGCAAACAGGATTAG (forward) and CCTAAGGCACAAACCCATCTC (reverse).…”