A Species-Specific PCR Assay Based on the Calmodulin Partial Gene for Identification of Fusarium Verticillioides, F. Proliferatum and F. Subglutinans

Mulé, Giuseppina; Susca, Antonia; Stea, Gaetano; Moretti, Antonio

doi:10.1023/b:ejpp.0000032389.84048.71

Cited by 173 publications

(91 citation statements)

References 23 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…DNA isolation and PCR amplification DNA extraction was carried out according to Badali et al (2009) The PCR reaction amplified the regions ITS1-5,8S-ITS2 of ribosomal DNA, partial β-tubulin gene, and partial calmodulin gene with the following pairs of primers: ITS1 5'TCCGTAGGTGAACCTGCGG3' and ITS4 5'TCCTCCGCTTATTGATATGC3' (White et al, 1990), Bt2a 5'GGTAACCAAATCGGTGCTGCTTTC3' and Bt2b 5'ACCCTCAGTGTAGTGACCCTTGGC3' (Glass and Donaldson, 1995), and CL1 5'GARTWCAAGGAGGCCTTCTC3', and CL2A 5'TTTTGCATCATGAGTTGGAC3' (Mulè et al, 2004), respectively.…”

Section: Molecular Characterizationmentioning

confidence: 99%

Potential of endophytic fungi as biocontrol agents of Duponchelia fovealis (Zeller) (Lepidoptera:Crambidae)

et al. 2017

View full text Add to dashboard Cite

This study reports the first assessment of endophytic fungi isolated from strawberry leaves and selection of isolates for the control of Duponchelia fovealis, a new pest of strawberries. A total of 400 strawberry leaves of the cultivar 'Albion' were collected in four commercial farms. Leaves were disinfected, cut in fragments, and placed on Petri dishes containing potato dextrose agar media with tetracycline and incubated for 30 days. Following this time, 517 fungal colonies were isolated, and thirteen genera were identified: Cladosporium, Aspergillus, Nigrospora, Fusarium, Trichoderma, Chaetomium, Alternaria, Paecilomyces, Penicillium, Ulocladium, Bipolaris, Diaporthe, and Phoma. Eight isolates belonging to the genera Aspergillus, Diaporthe, Paecilomyces, and Cladosporium were selected for pathogenicity bioassays against third instar larvae of D. fovealis. Isolates of Paecilomyces induced the highest mortality rates.

show abstract

Section: Molecular Characterizationmentioning

confidence: 99%

Potential of endophytic fungi as biocontrol agents of Duponchelia fovealis (Zeller) (Lepidoptera:Crambidae)

et al. 2017

View full text Add to dashboard Cite

show abstract

“…End-Point PCR was carried out using the SUB1 (CTGTCGCTAAC-CTCTTTATCCA) and SUB2 (CAGTATGGACGTTGGTATTATATCTAA) primer for the detection of F. subglutinans; the PRO1 (CTTTCCGC-CAAGTTTCTTC) and PRO2 (TGTCAGTAACTCGACGTTGTTG) primer for the detection of F. proliferatum; the VER1 (CTTCCTGCGAT-GTTTCTCC) and VER2 (AATTGGCCATTGGTATTATATATCTA) primer for the detection of F. verticilliodes, all designed by Mulè et al, 2004 on the calmodulin gene. These primers amplify respectively 631 bp for F. subglutinans, 585 bp for F. proliferatum and 578 bp for F. verticillioides.…”

Section: Preliminary Species-specific Pcrmentioning

confidence: 99%

“…Quantification of F. verticillioides, F. proliferatum and F. subglutinans using Real Time PCR The primers used for the detection of F. subglutinans were Fsub565 F (TCATTGGTATGTTGTCGCTCATG) and Fsub622A R (GTGATATGTTAGTACGAATAAAGGGAGAAC), designed on the EF1g ene (Nicolaisen et al, 2009;Boutigny et al, 2012). The primers Fp3-F (CGGCCACCAGAGGATGTG) and Fp4-R (CAACACGAATCGCT TCCTGAC), designed by Jurado et al (2006) on the intergenic sequence of the ribosomal RNA gene cluster, for the detection of F. proliferatum and the primers VER1 and VER2, designed by Mulè et al, 2004 on the calmodulin gene, for the detection of F. verticilliodes, were used in Real Time as described by Nutz et al (2011); all were synthesized by PRIMM (PRIMM srl, Milan, Italy).…”

Section: Preliminary Species-specific Pcrmentioning

confidence: 99%

Relationship between European Corn Borer injury, Fusarium proliferatum and F. subglutinans infection and moniliformin contamination in maize

Scarpino

Reyneri

Vanara

et al. 2015

Field Crops Research

View full text Add to dashboard Cite

“…Successively smaller-sized propagules are impacted on the upper, middle and lower stages, respectively. a Sampling at 150 cm; b sampling at 10 cm F. verticillioides, F. proliferatum and F. subglutinans, respectively (Mulé et al 2004). The reaction mixtures were prepared in a total volume of 25 ll with a final concentration of 10 mM 1 9 PCR buffer, 1 mM of dNTP and 2 mM of MgCl 2 .…”

Section: Methodsmentioning

confidence: 99%

Identification of airborne propagules of the Gibberella fujikuroi species complex during maize production

et al. 2011

View full text Add to dashboard Cite

The airborne dispersal of the anamorphs of the Gibberella fujikuroi species complex was studied under pre-and postharvest maize (corn) production conditions using a 3-stage Andersen sampler. The aim of this study was to identify and analyse the size distribution of such species in air samples. Differences were observed between the concentration of large-and small-sized propagules (identified as aggregates and single microconidia, respectively), but the difference was only significant during a high concentration period (October 2007, P = 0.009). No correlation was found between the concentration of fusaria found at different sampling heights (10 and 150 cm above ground level). Fusarium isolates were collected and identified based on morphological characters and using species-specific PCR assays. The PCR analysis confirmed morphological identification of F. verticillioides, F. proliferatum and F. subglutinans. High concentrations were found during the maize harvest, loading and corn shelling. Our results showed that the monitoring of F. verticillioides should be performed at a single sampling height.

show abstract

A Species-Specific PCR Assay Based on the Calmodulin Partial Gene for Identification of Fusarium Verticillioides, F. Proliferatum and F. Subglutinans

Cited by 173 publications

References 23 publications

Potential of endophytic fungi as biocontrol agents of Duponchelia fovealis (Zeller) (Lepidoptera:Crambidae)

Potential of endophytic fungi as biocontrol agents of Duponchelia fovealis (Zeller) (Lepidoptera:Crambidae)

Relationship between European Corn Borer injury, Fusarium proliferatum and F. subglutinans infection and moniliformin contamination in maize

Identification of airborne propagules of the Gibberella fujikuroi species complex during maize production

Contact Info

Product

Resources

About