A Simple and Immediate Method for Simultaneously Evaluating Expression Level and Plasmid Maintenance in Yeast

Abstract

To allow the comprehensive assessments of yeast expression systems, a simple and immediate method for simultaneously evaluating the expression level and plasmid maintenance in yeast was demonstrated. This method uses green fluorescent protein (GFP) and flow cytometry (FCM) and is characterized by a dual analysis of the average intensity of GFP fluorescence and the population of GFP-expressing cells. The FCM analysis of GFP fluorescence intensity rapidly quantifies the expression level without complex manipulations, such as the enzymatic reaction of a lacZ reporter assay. Moreover, the single-cell analysis revealed that the proportion of cells expressing GFP in the cell cluster reflects the plasmid retention rate; therefore, the FCM analysis of the GFP-expressing population allows the immediate estimation of the plasmid retention rate without the 2- or 3-day incubation required for colony counting. We show that the FCM analysis with GFP reporter is a suitable method to explore the hopeful expression vector and host strain or establish the several expression systems exhibiting the characteristic properties in yeast.

Improvement of glutathione production by metabolic engineering the sulfate assimilation pathway of Saccharomyces cerevisiae

“…The amplified fragments from APA1, MET3 and MET14 genes were digested with SalI and inserted into the SalI site of pAUR123 (Takara) to construct pAUR-APA1, pAUR-MET3 and pAUR-MET14, respectively. An amplified fragment from the MET16 gene using primers 5′-CTACTAGTATGAA GACCTATCATTTGAATAATGATATAATTGTCACAC-3′ (SpeI site is underlined) and 5′-TCTAGATCTCTAGG CATCTTGCTTTAAAAATTGCGCG-3′ (BglII site is underlined) was digested with SpeI and BglII and inserted into the NheI/BamHI site of pGK402 (Ishii et al 2009) to construct pGK402-MET16. The digested fragment of pGK402-MET16 with KpnI and SacI was subcloned into the KpnI/SacI site of pAUR112 (Takara) to construct pAUR-MET16.…”

“…Plasmid pRS405-MET14 was constructed by insertion of the BamHI-digested fragment from plasmid pAUR-MET14 into the BamHI site of pRS405 (Leucine marker) vector (Ishii et al 2009). Plasmid pRS406-MET16 was constructed by insertion of the SacI/KpnI-digested fragment from the plasmid pAUR-MET16 into the SacI/KpnI site of the pRS406 (Uracil marker) vector (Ishii et al 2009).…”

“…Plasmid pRS406-MET16 was constructed by insertion of the SacI/KpnI-digested fragment from the plasmid pAUR-MET16 into the SacI/KpnI site of the pRS406 (Uracil marker) vector (Ishii et al 2009). To construct combinatorial mutant strains which expressed δ-integrated GCS/GS genes and a single-integrated MET14 gene or MET16 gene, the GCS/GS δ-integrated host strain was transformed by EcoRV-digested pRS405-MET14 or pRS406-MET16, respectively.…”

Ethanol production from cellulosic materials using cellulase‐expressing yeast

“…The DNA fragment encoding the secretion signal sequence derived from Rhizopus oryzae glucoamylase, BGL1, and α-agglutinin was amplified by PCR using pIBG13 [14] as the template with the following primers: 5′-GCTCTAGAATGCAACTGTTCAA TTTGCCATTGAAAG-3′ and 5′-GCTCATGATTTG ATTATGTTCTTTCTATTTGAATGAGATATG-3′. The amplified fragment was digested with XhoI and ligated into pGK403 [15]. The resultant plasmid was named pIHAGBGL.Then the promoter region was amplified by PCR using pIHAGBGL as the template with the following primers: 5′-ATGCGCT AGCGCGGCCGCCGATTTGGGCGCGAATCC TTTA-3′ and 5′-GCATGCTAGCTGTTTTATATTT GTTGTAAA-3′.…”

“…The DNA fragment encoding the secretion signal sequence from R. oryzae, the CBHII gene, and the 3′ half of α-agglutinin was prepared by PCR using pFCBH2w3 [5] with the following primers: 5′-G C T C TA G A AT G CA A C T G T T CA AT T T G C C ATTGAAAG-3′ and 5′-GCTCTAGATTTGATTATG TTCTTTCTATTTGAATGAGATATG-3′. The amplified fragment was digested with XbaI and ligated into pGK406 [15]. This plasmid was named pGK406CBHII.…”