A review of the genus Rusa in the indo-malayan archipelago and conservation efforts

Ali, N.; Abdullah, Mohd Lutfi; Nor, Siti Azizah Mohd; Tan, Min Pau; Kulaimi, Noor Azleen Mohd; Naim, Darlina Md.

doi:10.1016/j.sjbs.2020.08.024

Cited by 12 publications

(8 citation statements)

References 66 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…After the five Islamic boarding schools were established, various Islamic boarding schools appeared in the archipelago, like mushrooms in the rainy season. This is an essential feature of the existence of Islamic educational institutions and, at the same time, education with the character of the Archipelago (Ali et al, 2021).…”

Section: Results and Discussion 1 History Of The Establishment Of Lpimentioning

confidence: 98%

New Paradigm of Indonesian Islamic Education: Analysis of Changes in the Relations of Islamic Education Institutions with Post-Reform Political Power

Sumarna¹

2023

View full text Add to dashboard Cite

Islamic Education Institutions (LPI) were born with different characters and ideologies from Dutch and Japanese educational institutions. This difference is still maintained even though Indonesia has declared itself independent. Only later in the reform era did the dynamics of the relationship between LPI and government power change. This study then examines changes in the relationship between the LPI and political power after the Reformation. This research will be carried out using qualitative methods and a historiographical approach. Researchers will use data on Indonesia’s social, political, and religious situation from when the Dutch colonized Indonesia until the temporary Indonesian period. This research then found a new change in the political movement of Islamic education in Indonesia in 1998. In this change, various Islamic educational institutions began to enter the political context and fill multiple positions in the government. Islamic educational institutions started to transform and become part of political power, which marked a paradigmatic change in the politics of Islamic education.

show abstract

Section: Results and Discussion 1 History Of The Establishment Of Lpimentioning

confidence: 98%

New Paradigm of Indonesian Islamic Education: Analysis of Changes in the Relations of Islamic Education Institutions with Post-Reform Political Power

Sumarna¹

2023

View full text Add to dashboard Cite

show abstract

“…Javan deer commonly lived in groups called herds (Ali et al 2021). Therefore, the behavioural observation was conducted using the scan sampling method, which observed most individuals' animal behaviours in a herd of deer (Altmann 1974).…”

Section: Javan Deer Encountermentioning

confidence: 99%

“…Javan deer (Rusa timorensis, de Blainville 1822) or also called Timor deer, is a species that belongs to the Cervidae and is native to Indonesian islands, particularly Java and Bali, and had been introduced to other Indonesian islands and overseas (Hedges et al 2015;Ali et al 2021). Categorised as Vulnerable by IUCN in 2015, the Javan deer is protected by the Indonesian Government through the Regulation of Minister of Environment and Forestry No.…”

Section: Introductionmentioning

confidence: 99%

“…P.20/Menlhk/Setjen/Kum.1/6/2018 concerning Protected Species of Plants and Animals. Javan deer have significant roles in ecology, economics, and socio-cultural, specifically since the species domesticated for commercial meat and antlers managed to be a game -hunting animal and being invasive feral populations outside Indonesia (Hedges et al 2015;Ali et al 2021). However, Javan deer deal with extermination in many highly human-populated areas, including poaching, habitat loss, livestock competition, predator threats, diseases, and natural disasters (Rahman et al 2020).…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Alternative Strategy to Improve the Conservation of Javan Deer in Pangandaran Nature Reserve, West Java, Indonesia

Firdaus

Irwanto²,

Sumarga³

2023

J.Tropical Biodiversity Biotechnology

View full text Add to dashboard Cite

The habitat of Javan deer in Pangandaran Nature Reserve (PNR) faced natural changes, particularly due to the succession process of vegetation community in grazing areas, and inadequate infrastructures that affected the deer to roam outside PNR. This study aimed to formulate strategies for the conservation of Javan deer in PNR, focusing on ecological aspects and conservation management. The methods were encountering Javan deer individuals; scan sampling and continuous recording to observe the behaviour of Javan deer; calculating the productivity of grazing area by defoliation experiment and vegetation analysis; reviewing documents, reports and interviews; and analysing strategy using SWOT-QSPM. Results showed there were 43 Javan deer encountered roaming in PNR and outside the conservation area, and nine individuals gathered in Cikamal grassland. The productivity of the grazing areas (5.61 ha) was 93,826 kg of feed annually and was only sufficient for 23 individuals. The grazing areas were dominated by Cynodon dactylon. Javan deer spent their time feeding. Javan deer herd in Cikamal is more intolerant to humans compared to the herd in Pangandaran Nature Tourist Park (PNTP). This study recommends: considering the management status of Javan deer in the conservation management of PNR and PNTP; improving the conservation management of Javan deer and its habitat; improving facilities and the management system of those facilities and conservation-supporting infrastructures; collaboration with researchers to perform some research and innovations for Javan deer conservation; improving the capability of PNR staff theoretically and practically; and educating and empowering the local people in terms of Javan deer conservation.

show abstract

“…Rusa timorensis are the largest deer species and they are medium-sized deer, rough-coated deer and anthropogenic activities of R. timorensis influenced by habitat, human hunting activities and translocation (Ali et al, 2021). The criteria that effect the antropogenic activities of this deer species lead to substantial impact on genetic diversity and the long-term conservation of local population of this species.…”

Section: Introductionmentioning

confidence: 99%

A preliminary investigation of genetic diversity amongst Rusa timorensis in Tanjung Malim, Perak and Bilut Agro Farm, Pahang, Malaysia

Krishnan

2022

JTRSS

View full text Add to dashboard Cite

A study on genetic diversity analysis was conducted on Rusa timorensis obtained from state of Perak and state of Pahang to investigate the level of genetic diversity occur and to compare the diversity amongst two R. timorensis breeders in Malaysia. A total of six (n=6) individual samples of R. timorensis were extracted from Tanjung Malim, Perak and Bilut Agro Farm, Pahang and amplified using mitochondria deoxyribonucleic acid (mtDNA) primers gene as a target molecular marker. The mtDNA region was amplified using a set of cytochrome b gene primers (5”AAACCAGAAAAGGAGAGCAAC3”;5”TCATCTAGGCATTTTCAGTGCC3”) and nucleotide sequence of the mtDNA cyt b was aligned by using MEGA Ver 7.0. The result indicated that the R. timorensis from Pahang has a low degree of variation (0.252) of genetic distance compared to, R. timorensis from Perak (0.696). The phylogenetic three analysis, indicated, R. timorensis from Pahang resulted the highest intra-specific relationship at 100% compared to , R. timorensis from Perak at 63% of intra-specific relationship. The results showed that the genetic diversity of, R. timorensis in Perak and Pahang is likely to decrease in the future. Therefore, future breeding program plan needs to be implemented to diversify the genetics of genus Rusa in Malaysia.

show abstract

A review of the genus Rusa in the indo-malayan archipelago and conservation efforts

Cited by 12 publications

References 66 publications

New Paradigm of Indonesian Islamic Education: Analysis of Changes in the Relations of Islamic Education Institutions with Post-Reform Political Power

New Paradigm of Indonesian Islamic Education: Analysis of Changes in the Relations of Islamic Education Institutions with Post-Reform Political Power

Alternative Strategy to Improve the Conservation of Javan Deer in Pangandaran Nature Reserve, West Java, Indonesia

A preliminary investigation of genetic diversity amongst Rusa timorensis in Tanjung Malim, Perak and Bilut Agro Farm, Pahang, Malaysia

Contact Info

Product

Resources

About